EMAIL THIS PAGE TO A FRIEND

TCTN2

tectonic family member 2

Synonyms: C12orf38 MKS8 TECT2
UniProtKB ID: Q96GX1, A8K7Y8, B3KPW5, Q9H966
Gene ID:
Human(79867) Summary: This gene encodes a type I membrane protein that belongs to the tectonic family. Studies in mice suggest that this protein may be involved in hedgehog signaling, and essential for ciliogenesis. Mutations in this gene are associated with Meckel syndrome type 8. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(67978) tectonic family member 2
Rat(689779) tectonic family member 2
naked mole-rat(101698943) tectonic family member 2
domestic guinea pig(101787809) tectonic family member 2
cow(100847961) tectonic family member 2
sheep(101121804) tectonic family member 2
Zebrafish(563835) tectonic family member 2
chicken(100857705) tectonic family member 2
dog(477445) tectonic family member 2
domestic cat(101085243) tectonic family member 2
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024809 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026486 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026486 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026486 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050711 MISSION® esiRNA esiRNA human TCTN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024809 Rosetta Predictions human pricing
NM_001080782 Rosetta Predictions rat pricing
NM_026486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236641 predicted 524
2 SASI_Hs01_00236643 predicted 1326
3 SASI_Hs02_00357356 predicted 537
4 SASI_Hs02_00357357 predicted 1154
5 SASI_Hs01_00236645 predicted 1553
6 SASI_Hs01_00236646 predicted 1053
7 SASI_Hs01_00236647 predicted 1084
8 SASI_Hs01_00236648 predicted 497
9 SASI_Hs02_00357358 predicted 863
10 SASI_Hs01_00236649 predicted 1369
11 SASI_Hs01_00236642 predicted 1849
12 SASI_Hs01_00236644 predicted 1612
13 SASI_Hs01_00236650 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208499 predicted 1907
2 SASI_Rn02_00208500 predicted 1152
3 SASI_Rn02_00208501 predicted 2163
4 SASI_Rn02_00208502 predicted 1419
5 SASI_Rn02_00208503 predicted 1046
6 SASI_Rn02_00208504 predicted 739
7 SASI_Rn02_00208505 predicted 1259
8 SASI_Rn02_00208506 predicted 1563
9 SASI_Rn02_00208507 predicted 684
10 SASI_Rn02_00208508 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128967 predicted 1245
2 SASI_Mm01_00128968 predicted 1254
3 SASI_Mm01_00128969 predicted 913
4 SASI_Mm01_00128970 predicted 1101
5 SASI_Mm01_00128971 predicted 1952
6 SASI_Mm01_00128973 predicted 589
7 SASI_Mm01_00128974 predicted 547
8 SASI_Mm01_00128975 predicted 1960
9 SASI_Mm01_00128976 predicted 1363
10 SASI_Mm02_00330358 predicted 1027
11 SASI_Mm01_00128972 predicted 1281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024809
VALIDATED
TCTN2 MISSION shRNA Bacterial Glycerol Stock
tectonic family member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024809.2-1604s1c1
Sequence:CCGGGAGAATGCTGTTGAAAGACTTCTCGAGAAGTCTTTCAACAGCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024809.2-503s1c1
Sequence:CCGGCATCTACTCATTCAAGTGGAACTCGAGTTCCACTTGAATGAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024809.2-942s1c1
Sequence:CCGGGAGATCCCATTATGACTGTAACTCGAGTTACAGTCATAATGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024809.2-415s1c1
Sequence:CCGGCTCCAATGAGACAGATTCCTTCTCGAGAAGGAATCTGTCTCATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024809.2-532s1c1
Sequence:CCGGCAACTCTTCTCTGACCCATAACTCGAGTTATGGGTCAGAGAAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024809.2-1171s1c1
Sequence:CCGGCCTAGACAAATTCATCACCAACTCGAGTTGGTGATGAATTTGTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024809.2-1940s1c1
Sequence:CCGGGCATCCGTCCAGTTTATTAAACTCGAGTTTAATAAACTGGACGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024809.3-2646s21c1
Sequence:CCCGGACCACAGATGCTCCACCATGCTCGAGCATGGTGGAGCATCTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024809.3-1485s21c1
Sequence:CCGGATGAATAATGTCACGACTTTACTCGAGTAAAGTCGTGACATTATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024809
VALIDATED
TCTN2 MISSION shRNA shRNA Plasmid DNA
tectonic family member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024809.2-1604s1c1
Sequence:CCGGGAGAATGCTGTTGAAAGACTTCTCGAGAAGTCTTTCAACAGCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024809.2-503s1c1
Sequence:CCGGCATCTACTCATTCAAGTGGAACTCGAGTTCCACTTGAATGAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024809.2-942s1c1
Sequence:CCGGGAGATCCCATTATGACTGTAACTCGAGTTACAGTCATAATGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024809.2-415s1c1
Sequence:CCGGCTCCAATGAGACAGATTCCTTCTCGAGAAGGAATCTGTCTCATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024809.2-532s1c1
Sequence:CCGGCAACTCTTCTCTGACCCATAACTCGAGTTATGGGTCAGAGAAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024809.2-1171s1c1
Sequence:CCGGCCTAGACAAATTCATCACCAACTCGAGTTGGTGATGAATTTGTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024809.2-1940s1c1
Sequence:CCGGGCATCCGTCCAGTTTATTAAACTCGAGTTTAATAAACTGGACGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024809.3-2646s21c1
Sequence:CCCGGACCACAGATGCTCCACCATGCTCGAGCATGGTGGAGCATCTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024809.3-1485s21c1
Sequence:CCGGATGAATAATGTCACGACTTTACTCGAGTAAAGTCGTGACATTATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024809
VALIDATED
TCTN2 MISSION shRNA Lentiviral Transduction Particles
tectonic family member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024809.2-1604s1c1
Sequence:CCGGGAGAATGCTGTTGAAAGACTTCTCGAGAAGTCTTTCAACAGCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024809.2-503s1c1
Sequence:CCGGCATCTACTCATTCAAGTGGAACTCGAGTTCCACTTGAATGAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024809.2-942s1c1
Sequence:CCGGGAGATCCCATTATGACTGTAACTCGAGTTACAGTCATAATGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024809.2-415s1c1
Sequence:CCGGCTCCAATGAGACAGATTCCTTCTCGAGAAGGAATCTGTCTCATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024809.2-532s1c1
Sequence:CCGGCAACTCTTCTCTGACCCATAACTCGAGTTATGGGTCAGAGAAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024809.2-1171s1c1
Sequence:CCGGCCTAGACAAATTCATCACCAACTCGAGTTGGTGATGAATTTGTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024809.2-1940s1c1
Sequence:CCGGGCATCCGTCCAGTTTATTAAACTCGAGTTTAATAAACTGGACGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024809.3-2646s21c1
Sequence:CCCGGACCACAGATGCTCCACCATGCTCGAGCATGGTGGAGCATCTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024809.3-1485s21c1
Sequence:CCGGATGAATAATGTCACGACTTTACTCGAGTAAAGTCGTGACATTATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026486
VALIDATED
TCTN2 MISSION shRNA Bacterial Glycerol Stock
tectonic family member 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026486.1-1212s1c1
Sequence:CCGGCCCAGAAACGTGAATGTGGAACTCGAGTTCCACATTCACGTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026486.1-542s1c1
Sequence:CCGGCCACAACGCATCAGAGAACATCTCGAGATGTTCTCTGATGCGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026486.1-1970s1c1
Sequence:CCGGCCCTACGAGATTCCAGATCAACTCGAGTTGATCTGGAATCTCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026486.1-2249s1c1
Sequence:CCGGCCTCTCTGAAACCTGTCAGTTCTCGAGAACTGACAGGTTTCAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026486.1-918s1c1
Sequence:CCGGGCCAGTTACAAGCAAGGAGATCTCGAGATCTCCTTGCTTGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026486.3-395s21c1
Sequence:CCGGGCACGCTGGAAGTGACCATAACTCGAGTTATGGTCACTTCCAGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026486.3-538s21c1
Sequence:CCGGCTCATCCAGGTGGAGATTTATCTCGAGATAAATCTCCACCTGGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026486
VALIDATED
TCTN2 MISSION shRNA shRNA Plasmid DNA
tectonic family member 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026486.1-1212s1c1
Sequence:CCGGCCCAGAAACGTGAATGTGGAACTCGAGTTCCACATTCACGTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026486.1-542s1c1
Sequence:CCGGCCACAACGCATCAGAGAACATCTCGAGATGTTCTCTGATGCGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026486.1-1970s1c1
Sequence:CCGGCCCTACGAGATTCCAGATCAACTCGAGTTGATCTGGAATCTCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026486.1-2249s1c1
Sequence:CCGGCCTCTCTGAAACCTGTCAGTTCTCGAGAACTGACAGGTTTCAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026486.1-918s1c1
Sequence:CCGGGCCAGTTACAAGCAAGGAGATCTCGAGATCTCCTTGCTTGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026486.3-395s21c1
Sequence:CCGGGCACGCTGGAAGTGACCATAACTCGAGTTATGGTCACTTCCAGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026486.3-538s21c1
Sequence:CCGGCTCATCCAGGTGGAGATTTATCTCGAGATAAATCTCCACCTGGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026486
VALIDATED
TCTN2 MISSION shRNA Lentiviral Transduction Particles
tectonic family member 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026486.1-1212s1c1
Sequence:CCGGCCCAGAAACGTGAATGTGGAACTCGAGTTCCACATTCACGTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026486.1-542s1c1
Sequence:CCGGCCACAACGCATCAGAGAACATCTCGAGATGTTCTCTGATGCGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026486.1-1970s1c1
Sequence:CCGGCCCTACGAGATTCCAGATCAACTCGAGTTGATCTGGAATCTCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026486.1-2249s1c1
Sequence:CCGGCCTCTCTGAAACCTGTCAGTTCTCGAGAACTGACAGGTTTCAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026486.1-918s1c1
Sequence:CCGGGCCAGTTACAAGCAAGGAGATCTCGAGATCTCCTTGCTTGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026486.3-395s21c1
Sequence:CCGGGCACGCTGGAAGTGACCATAACTCGAGTTATGGTCACTTCCAGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026486.3-538s21c1
Sequence:CCGGCTCATCCAGGTGGAGATTTATCTCGAGATAAATCTCCACCTGGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks