EMAIL THIS PAGE TO A FRIEND

TCTN3

tectonic family member 3

Synonyms: C10orf61 JBTS18 OFD4 TECT3
Gene ID:
Human(26123) Summary: This gene encodes a member of the tectonic gene family which functions in Hedgehog signal transduction and development of the neural tube. Mutations in this gene have been associated with Orofaciodigital Syndrome IV and Joubert Syndrom 18. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2012]
Mouse(67590) tectonic family member 3
Rat(309486) tectonic family member 3
chicken(423974) tectonic family member 3
domestic cat(101096108) tectonic family member 3
dog(608523) tectonic family member 3
Horse(100070964) tectonic family member 3
cow(511035) tectonic family member 3
Goat(100861091) tectonic family member 3
sheep(101109403) tectonic family member 3
domestic guinea pig(100717158) tectonic family member 3
naked mole-rat(101714230) tectonic family member 3
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA026987 Anti-TCTN3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2103195 Anti-TCTN3 antibody produced in rabbit affinity isolated antibody rabbit, rat, canine, human, guinea pig, bovine, horse, mouse
western blot pricing
SAB3500520 Anti-TCTN3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015631 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013840 Rosetta Predictions human pricing
NM_015631 Rosetta Predictions human pricing
XM_001053561 Rosetta Predictions rat pricing
XM_220007 Rosetta Predictions rat pricing
NM_026260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155219 predicted 732
2 SASI_Hs01_00155220 predicted 757
3 SASI_Hs01_00155221 predicted 1863
4 SASI_Hs01_00155222 predicted 1839
5 SASI_Hs01_00155223 predicted 2120
6 SASI_Hs01_00155224 predicted 1577
7 SASI_Hs01_00155225 predicted 1700
8 SASI_Hs01_00155226 predicted 1461
9 SASI_Hs01_00155227 predicted 2154
10 SASI_Hs01_00155228 predicted 2032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068545 predicted 725
2 SASI_Hs01_00068547 predicted 1856
3 SASI_Hs01_00068548 predicted 1826
4 SASI_Hs01_00068550 predicted 1575
5 SASI_Hs01_00068551 predicted 1689
6 SASI_Hs02_00348224 predicted 1087
7 SASI_Hs01_00068552 predicted 1447
8 SASI_Hs02_00348225 predicted 1050
9 SASI_Hs01_00068553 predicted 2147
10 SASI_Hs01_00068554 predicted 2020
11 SASI_Hs01_00068546 predicted 918
12 SASI_Hs01_00068549 predicted 2205
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272780 predicted 1293
2 SASI_Rn02_00272781 predicted 1654
3 SASI_Rn02_00272782 predicted 1727
4 SASI_Rn02_00272783 predicted 1208
5 SASI_Rn02_00272784 predicted 743
6 SASI_Rn02_00272785 predicted 1487
7 SASI_Rn02_00272786 predicted 1283
8 SASI_Rn02_00272787 predicted 892
9 SASI_Rn02_00272788 predicted 598
10 SASI_Rn02_00272789 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378915 predicted 978
2 SASI_Rn02_00378916 predicted 1065
3 SASI_Rn02_00378917 predicted 1408
4 SASI_Rn02_00378918 predicted 1292
5 SASI_Rn02_00378919 predicted 1654
6 SASI_Rn02_00378920 predicted 1534
7 SASI_Rn02_00378921 predicted 1722
8 SASI_Rn02_00378922 predicted 1243
9 SASI_Rn02_00378923 predicted 1730
10 SASI_Rn02_00378924 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118682 predicted 1312
2 SASI_Mm01_00118683 predicted 1649
3 SASI_Mm02_00329949 predicted 985
4 SASI_Mm01_00118684 predicted 1604
5 SASI_Mm01_00118685 predicted 393
6 SASI_Mm01_00118686 predicted 439
7 SASI_Mm01_00118687 predicted 1904
8 SASI_Mm01_00118689 predicted 1935
9 SASI_Mm01_00118690 predicted 1894
10 SASI_Mm01_00118691 predicted 1292
11 SASI_Mm01_00118688 predicted 1210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015631
VALIDATED
TCTN3 MISSION shRNA Bacterial Glycerol Stock
tectonic family member 3
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015631.5-1107s21c1
Sequence:CCGGGCATGACTGATCCACAGAATACTCGAGTATTCTGTGGATCAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015631.5-1252s21c1
Sequence:CCGGCCAGAAAGTTTCTGTCAGTTTCTCGAGAAACTGACAGAAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015631.5-1810s21c1
Sequence:CCGGCCTATACCAGTGCCAGTCTATCTCGAGATAGACTGGCACTGGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015631.5-816s21c1
Sequence:CCGGGAGGCGAATCATTCACTTCAACTCGAGTTGAAGTGAATGATTCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1367s1c1
Sequence:CCGGGTAATGGAAGTTGCTCTGTTACTCGAGTAACAGAGCAACTTCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1471s1c1
Sequence:CCGGCAGGAGATTTATCAGACTCTTCTCGAGAAGAGTCTGATAAATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1064s1c1
Sequence:CCGGCAGTCTTAAAGGTTCCAAGAACTCGAGTTCTTGGAACCTTTAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1413s1c1
Sequence:CCGGGAATGCAATATCTGGATGCAACTCGAGTTGCATCCAGATATTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015631.1-1620s1c1
Sequence:CCGGCATACCAGTTTCCCTGGAGATCTCGAGATCTCCAGGGAAACTGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015631.1-1149s1c1
Sequence:CCGGCCAGAAAGTTTCTGTCAGTTTCTCGAGAAACTGACAGAAACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015631.1-1736s1c1
Sequence:CCGGCTCAGCAAGTTACAGAAGTATCTCGAGATACTTCTGTAACTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015631.1-1085s1c1
Sequence:CCGGGCATGACTGATCCACAGAATACTCGAGTATTCTGTGGATCAGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015631.1-1681s1c1
Sequence:CCGGCAAGCTCATGTATCAGGAGTTCTCGAGAACTCCTGATACATGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1707s1c1
Sequence:CCGGCCTATACCAGTGCCAGTCTATCTCGAGATAGACTGGCACTGGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015631.1-955s1c1
Sequence:CCGGGCAGGTTTCCTAGAGAGTAAACTCGAGTTTACTCTCTAGGAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-794s1c1
Sequence:CCGGGAGGCGAATCATTCACTTCAACTCGAGTTGAAGTGAATGATTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015631
VALIDATED
TCTN3 MISSION shRNA shRNA Plasmid DNA
tectonic family member 3
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015631.5-1107s21c1
Sequence:CCGGGCATGACTGATCCACAGAATACTCGAGTATTCTGTGGATCAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015631.5-1252s21c1
Sequence:CCGGCCAGAAAGTTTCTGTCAGTTTCTCGAGAAACTGACAGAAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015631.5-1810s21c1
Sequence:CCGGCCTATACCAGTGCCAGTCTATCTCGAGATAGACTGGCACTGGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015631.5-816s21c1
Sequence:CCGGGAGGCGAATCATTCACTTCAACTCGAGTTGAAGTGAATGATTCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1367s1c1
Sequence:CCGGGTAATGGAAGTTGCTCTGTTACTCGAGTAACAGAGCAACTTCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1471s1c1
Sequence:CCGGCAGGAGATTTATCAGACTCTTCTCGAGAAGAGTCTGATAAATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1064s1c1
Sequence:CCGGCAGTCTTAAAGGTTCCAAGAACTCGAGTTCTTGGAACCTTTAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1413s1c1
Sequence:CCGGGAATGCAATATCTGGATGCAACTCGAGTTGCATCCAGATATTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015631.1-1620s1c1
Sequence:CCGGCATACCAGTTTCCCTGGAGATCTCGAGATCTCCAGGGAAACTGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015631.1-1149s1c1
Sequence:CCGGCCAGAAAGTTTCTGTCAGTTTCTCGAGAAACTGACAGAAACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015631.1-1736s1c1
Sequence:CCGGCTCAGCAAGTTACAGAAGTATCTCGAGATACTTCTGTAACTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015631.1-1085s1c1
Sequence:CCGGGCATGACTGATCCACAGAATACTCGAGTATTCTGTGGATCAGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015631.1-1681s1c1
Sequence:CCGGCAAGCTCATGTATCAGGAGTTCTCGAGAACTCCTGATACATGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1707s1c1
Sequence:CCGGCCTATACCAGTGCCAGTCTATCTCGAGATAGACTGGCACTGGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015631.1-955s1c1
Sequence:CCGGGCAGGTTTCCTAGAGAGTAAACTCGAGTTTACTCTCTAGGAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-794s1c1
Sequence:CCGGGAGGCGAATCATTCACTTCAACTCGAGTTGAAGTGAATGATTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015631
VALIDATED
TCTN3 MISSION shRNA Lentiviral Transduction Particles
tectonic family member 3
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015631.5-1107s21c1
Sequence:CCGGGCATGACTGATCCACAGAATACTCGAGTATTCTGTGGATCAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015631.5-1252s21c1
Sequence:CCGGCCAGAAAGTTTCTGTCAGTTTCTCGAGAAACTGACAGAAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015631.5-1810s21c1
Sequence:CCGGCCTATACCAGTGCCAGTCTATCTCGAGATAGACTGGCACTGGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015631.5-816s21c1
Sequence:CCGGGAGGCGAATCATTCACTTCAACTCGAGTTGAAGTGAATGATTCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1367s1c1
Sequence:CCGGGTAATGGAAGTTGCTCTGTTACTCGAGTAACAGAGCAACTTCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1471s1c1
Sequence:CCGGCAGGAGATTTATCAGACTCTTCTCGAGAAGAGTCTGATAAATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1064s1c1
Sequence:CCGGCAGTCTTAAAGGTTCCAAGAACTCGAGTTCTTGGAACCTTTAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1413s1c1
Sequence:CCGGGAATGCAATATCTGGATGCAACTCGAGTTGCATCCAGATATTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015631.1-1620s1c1
Sequence:CCGGCATACCAGTTTCCCTGGAGATCTCGAGATCTCCAGGGAAACTGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015631.1-1149s1c1
Sequence:CCGGCCAGAAAGTTTCTGTCAGTTTCTCGAGAAACTGACAGAAACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015631.1-1736s1c1
Sequence:CCGGCTCAGCAAGTTACAGAAGTATCTCGAGATACTTCTGTAACTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015631.1-1085s1c1
Sequence:CCGGGCATGACTGATCCACAGAATACTCGAGTATTCTGTGGATCAGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015631.1-1681s1c1
Sequence:CCGGCAAGCTCATGTATCAGGAGTTCTCGAGAACTCCTGATACATGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-1707s1c1
Sequence:CCGGCCTATACCAGTGCCAGTCTATCTCGAGATAGACTGGCACTGGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015631.1-955s1c1
Sequence:CCGGGCAGGTTTCCTAGAGAGTAAACTCGAGTTTACTCTCTAGGAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015631.1-794s1c1
Sequence:CCGGGAGGCGAATCATTCACTTCAACTCGAGTTGAAGTGAATGATTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026260
VALIDATED
TCTN3 MISSION shRNA Bacterial Glycerol Stock
tectonic family member 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026260.2-1733s21c1
Sequence:CCGGGCTGCCATTCGATTTCTTCTTCTCGAGAAGAAGAAATCGAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026260.2-1908s21c1
Sequence:CCGGGCCTACTTATCTTGGCTAAATCTCGAGATTTAGCCAAGATAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026260.2-1359s21c1
Sequence:CCGGCACTTGCAGGAGGAGGTTTATCTCGAGATAAACCTCCTCCTGCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026260.2-1790s21c1
Sequence:CCGGGCAGAAAGACTCTCTCGTTCTCTCGAGAGAACGAGAGAGTCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026260.2-1790s1c1
Sequence:CCGGGCAGAAAGACTCTCTCGTTCTCTCGAGAGAACGAGAGAGTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026260.2-1733s1c1
Sequence:CCGGGCTGCCATTCGATTTCTTCTTCTCGAGAAGAAGAAATCGAATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026260.2-560s1c1
Sequence:CCGGCCAAACAGTCAATGCAACCAACTCGAGTTGGTTGCATTGACTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026260.2-1908s1c1
Sequence:CCGGGCCTACTTATCTTGGCTAAATCTCGAGATTTAGCCAAGATAAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026260
VALIDATED
TCTN3 MISSION shRNA shRNA Plasmid DNA
tectonic family member 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026260.2-1733s21c1
Sequence:CCGGGCTGCCATTCGATTTCTTCTTCTCGAGAAGAAGAAATCGAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026260.2-1908s21c1
Sequence:CCGGGCCTACTTATCTTGGCTAAATCTCGAGATTTAGCCAAGATAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026260.2-1359s21c1
Sequence:CCGGCACTTGCAGGAGGAGGTTTATCTCGAGATAAACCTCCTCCTGCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026260.2-1790s21c1
Sequence:CCGGGCAGAAAGACTCTCTCGTTCTCTCGAGAGAACGAGAGAGTCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026260.2-1790s1c1
Sequence:CCGGGCAGAAAGACTCTCTCGTTCTCTCGAGAGAACGAGAGAGTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026260.2-1733s1c1
Sequence:CCGGGCTGCCATTCGATTTCTTCTTCTCGAGAAGAAGAAATCGAATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026260.2-560s1c1
Sequence:CCGGCCAAACAGTCAATGCAACCAACTCGAGTTGGTTGCATTGACTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026260.2-1908s1c1
Sequence:CCGGGCCTACTTATCTTGGCTAAATCTCGAGATTTAGCCAAGATAAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026260
VALIDATED
TCTN3 MISSION shRNA Lentiviral Transduction Particles
tectonic family member 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026260.2-1733s21c1
Sequence:CCGGGCTGCCATTCGATTTCTTCTTCTCGAGAAGAAGAAATCGAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026260.2-1908s21c1
Sequence:CCGGGCCTACTTATCTTGGCTAAATCTCGAGATTTAGCCAAGATAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026260.2-1359s21c1
Sequence:CCGGCACTTGCAGGAGGAGGTTTATCTCGAGATAAACCTCCTCCTGCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026260.2-1790s21c1
Sequence:CCGGGCAGAAAGACTCTCTCGTTCTCTCGAGAGAACGAGAGAGTCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026260.2-1790s1c1
Sequence:CCGGGCAGAAAGACTCTCTCGTTCTCTCGAGAGAACGAGAGAGTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026260.2-1733s1c1
Sequence:CCGGGCTGCCATTCGATTTCTTCTTCTCGAGAAGAAGAAATCGAATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026260.2-560s1c1
Sequence:CCGGCCAAACAGTCAATGCAACCAACTCGAGTTGGTTGCATTGACTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026260.2-1908s1c1
Sequence:CCGGGCCTACTTATCTTGGCTAAATCTCGAGATTTAGCCAAGATAAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks