EMAIL THIS PAGE TO A FRIEND

TDG

thymine-DNA glycosylase

Synonyms: hTDG
UniProtKB ID: Q13569, Q8IUZ6, Q8IZM3
Gene ID:
Human(6996) Summary: The protein encoded by this gene belongs to the TDG/mug DNA glycosylase family. Thymine-DNA glycosylase (TDG) removes thymine moieties from G/T mismatches by hydrolyzing the carbon-nitrogen bond between the sugar-phosphate backbone of DNA and the mispaired thymine. With lower activity, this enzyme also removes thymine from C/T and T/T mispairings. TDG can also remove uracil and 5-bromouracil from mispairings with guanine. This enzyme plays a central role in cellular defense against genetic mutation caused by the spontaneous deamination of 5-methylcytosine and cytosine. This gene may have a pseudogene in the p arm of chromosome 12. [provided by RefSeq, Jul 2008]
Mouse(21665) thymine DNA glycosylase
Rat(114521) thymine-DNA glycosylase
Zebrafish(553789) thymine-DNA glycosylase
dog(475448) thymine-DNA glycosylase
domestic cat(101082502) thymine-DNA glycosylase
Horse(100053458) thymine-DNA glycosylase
chicken(395510) thymine-DNA glycosylase
cow(517825) thymine-DNA glycosylase
sheep(101123623) thymine-DNA glycosylase
naked mole-rat(101703457) thymine-DNA glycosylase
domestic guinea pig(100724604) thymine-DNA glycosylase
175 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003211 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008411 Rosetta Predictions human pricing
NM_003211 Rosetta Predictions human pricing
NM_053729 Rosetta Predictions rat pricing
NM_011561 Rosetta Predictions mouse pricing
NM_172552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108995 predicted 1287
2 SASI_Hs01_00108996 predicted 932
3 SASI_Hs01_00108997 predicted 992
4 SASI_Hs01_00108998 predicted 602
5 SASI_Hs01_00108999 predicted 1117
6 SASI_Hs01_00109000 predicted 839
7 SASI_Hs01_00109001 predicted 732
8 SASI_Hs01_00109002 predicted 671
9 SASI_Hs01_00109003 predicted 651
10 SASI_Hs01_00109004 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335245 predicted 928
2 SASI_Hs01_00152170 predicted 1070
3 SASI_Hs01_00152171 predicted 714
4 SASI_Hs01_00152172 predicted 1125
5 SASI_Hs01_00152173 predicted 746
6 SASI_Hs01_00152174 predicted 1254
7 SASI_Hs01_00152175 predicted 981
8 SASI_Hs01_00152176 predicted 861
9 SASI_Hs01_00152177 predicted 806
10 SASI_Hs01_00152178 predicted 795
11 SASI_Hs01_00152169 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053729 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042907 predicted 820
2 SASI_Rn01_00042909 predicted 456
3 SASI_Rn01_00042910 predicted 708
4 SASI_Rn02_00266497 predicted 1006
5 SASI_Rn01_00042911 predicted 632
6 SASI_Rn01_00042912 predicted 472
7 SASI_Rn01_00042913 predicted 452
8 SASI_Rn01_00042914 predicted 555
9 SASI_Rn01_00042915 predicted 816
10 SASI_Rn01_00042916 predicted 287
11 SASI_Rn01_00042908 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320915 predicted 357
2 SASI_Mm02_00320916 predicted 894
3 SASI_Mm02_00320917 predicted 527
4 SASI_Mm02_00320918 predicted 702
5 SASI_Mm02_00320919 predicted 782
6 SASI_Mm02_00320920 predicted 658
7 SASI_Mm02_00320921 predicted 1125
8 SASI_Mm02_00320922 predicted 1171
9 SASI_Mm02_00320923 predicted 1442
10 SASI_Mm02_00320924 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344172 predicted 450
2 SASI_Mm02_00344173 predicted 995
3 SASI_Mm01_00114683 predicted 626
4 SASI_Mm02_00344174 predicted 807
5 SASI_Mm02_00344175 predicted 878
6 SASI_Mm02_00344176 predicted 754
7 SASI_Mm02_00344177 predicted 1223
8 SASI_Mm02_00344178 predicted 1265
9 SASI_Mm02_00344179 predicted 1536
10 SASI_Mm01_00114685 predicted 603
11 SASI_Mm01_00114684 predicted 562
12 SASI_Mm01_00114686 predicted 564
13 SASI_Mm01_00114687 predicted 536
14 SASI_Mm01_00114688 predicted 528
15 SASI_Mm01_00114689 predicted 527
16 SASI_Mm01_00114690 predicted 554
17 SASI_Mm01_00114691 predicted 556
18 SASI_Mm01_00114692 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003211
VALIDATED
TDG MISSION shRNA Bacterial Glycerol Stock
thymine-DNA glycosylase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003211.2-1357s1c1
Sequence:CCGGCCTTTAGTAATCACTGTGGAACTCGAGTTCCACAGTGATTACTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003211.2-573s1c1
Sequence:CCGGGACATTGTCATTATTGGCATACTCGAGTATGCCAATAATGACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003211.2-1083s1c1
Sequence:CCGGGAACGAAATATGGACGTTCAACTCGAGTTGAACGTCCATATTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003211.2-274s1c1
Sequence:CCGGCAGTTGTGAATGAACAGCAAACTCGAGTTTGCTGTTCATTCACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003211.4-1130s21c1
Sequence:CCGGGAACGAAATATGGACGTTCAACTCGAGTTGAACGTCCATATTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003211.4-298s21c1
Sequence:CCGGGATGGCTGAAGCTCCTAATATCTCGAGATATTAGGAGCTTCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003211.4-845s21c1
Sequence:CCGGTTTCGTGAAGGAGGACGTATTCTCGAGAATACGTCCTCCTTCACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_003211.4-1951s21c1
Sequence:CCGGCAGGGTTCCCTGAGCTATATGCTCGAGCATATAGCTCAGGGAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003211.4-658s21c1
Sequence:CCGGTGCTTACAAAGGGCATCATTACTCGAGTAATGATGCCCTTTGTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003211
VALIDATED
TDG MISSION shRNA shRNA Plasmid DNA
thymine-DNA glycosylase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003211.2-1357s1c1
Sequence:CCGGCCTTTAGTAATCACTGTGGAACTCGAGTTCCACAGTGATTACTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003211.2-573s1c1
Sequence:CCGGGACATTGTCATTATTGGCATACTCGAGTATGCCAATAATGACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003211.2-1083s1c1
Sequence:CCGGGAACGAAATATGGACGTTCAACTCGAGTTGAACGTCCATATTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003211.2-274s1c1
Sequence:CCGGCAGTTGTGAATGAACAGCAAACTCGAGTTTGCTGTTCATTCACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003211.4-1130s21c1
Sequence:CCGGGAACGAAATATGGACGTTCAACTCGAGTTGAACGTCCATATTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003211.4-298s21c1
Sequence:CCGGGATGGCTGAAGCTCCTAATATCTCGAGATATTAGGAGCTTCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003211.4-845s21c1
Sequence:CCGGTTTCGTGAAGGAGGACGTATTCTCGAGAATACGTCCTCCTTCACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_003211.4-1951s21c1
Sequence:CCGGCAGGGTTCCCTGAGCTATATGCTCGAGCATATAGCTCAGGGAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003211.4-658s21c1
Sequence:CCGGTGCTTACAAAGGGCATCATTACTCGAGTAATGATGCCCTTTGTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003211
VALIDATED
TDG MISSION shRNA Lentiviral Transduction Particles
thymine-DNA glycosylase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003211.2-1357s1c1
Sequence:CCGGCCTTTAGTAATCACTGTGGAACTCGAGTTCCACAGTGATTACTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003211.2-573s1c1
Sequence:CCGGGACATTGTCATTATTGGCATACTCGAGTATGCCAATAATGACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003211.2-1083s1c1
Sequence:CCGGGAACGAAATATGGACGTTCAACTCGAGTTGAACGTCCATATTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003211.2-274s1c1
Sequence:CCGGCAGTTGTGAATGAACAGCAAACTCGAGTTTGCTGTTCATTCACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003211.4-1130s21c1
Sequence:CCGGGAACGAAATATGGACGTTCAACTCGAGTTGAACGTCCATATTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003211.4-298s21c1
Sequence:CCGGGATGGCTGAAGCTCCTAATATCTCGAGATATTAGGAGCTTCAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003211.4-845s21c1
Sequence:CCGGTTTCGTGAAGGAGGACGTATTCTCGAGAATACGTCCTCCTTCACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_003211.4-1951s21c1
Sequence:CCGGCAGGGTTCCCTGAGCTATATGCTCGAGCATATAGCTCAGGGAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003211.4-658s21c1
Sequence:CCGGTGCTTACAAAGGGCATCATTACTCGAGTAATGATGCCCTTTGTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172552
VALIDATED
TDG MISSION shRNA Bacterial Glycerol Stock
thymine-DNA glycosylase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172552.1-1209s1c1
Sequence:CCGGGCATTGCTTCAAATGGGCTAACTCGAGTTAGCCCATTTGAAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172552.1-501s1c1
Sequence:CCGGCCAAGACTCTTCCTGACATTTCTCGAGAAATGTCAGGAAGAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172552.1-3001s1c1
Sequence:CCGGCCAGCAGGATTTAATGGTATTCTCGAGAATACCATTAAATCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172552.1-1108s1c1
Sequence:CCGGCGCAAAGAAGATGGCTGTTAACTCGAGTTAACAGCCATCTTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172552.1-808s1c1
Sequence:CCGGGCCACGAATAGCGGTGTTTAACTCGAGTTAAACACCGCTATTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172552.3-1131s21c1
Sequence:CCGGACGTTCAGGAAGTGCAGTATACTCGAGTATACTGCACTTCCTGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172552.3-809s21c1
Sequence:CCGGAGCAAGGATCTGTCTAGTAAACTCGAGTTTACTAGACAGATCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172552
VALIDATED
TDG MISSION shRNA shRNA Plasmid DNA
thymine-DNA glycosylase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172552.1-1209s1c1
Sequence:CCGGGCATTGCTTCAAATGGGCTAACTCGAGTTAGCCCATTTGAAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172552.1-501s1c1
Sequence:CCGGCCAAGACTCTTCCTGACATTTCTCGAGAAATGTCAGGAAGAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172552.1-3001s1c1
Sequence:CCGGCCAGCAGGATTTAATGGTATTCTCGAGAATACCATTAAATCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172552.1-1108s1c1
Sequence:CCGGCGCAAAGAAGATGGCTGTTAACTCGAGTTAACAGCCATCTTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172552.1-808s1c1
Sequence:CCGGGCCACGAATAGCGGTGTTTAACTCGAGTTAAACACCGCTATTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172552.3-1131s21c1
Sequence:CCGGACGTTCAGGAAGTGCAGTATACTCGAGTATACTGCACTTCCTGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172552.3-809s21c1
Sequence:CCGGAGCAAGGATCTGTCTAGTAAACTCGAGTTTACTAGACAGATCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172552
VALIDATED
TDG MISSION shRNA Lentiviral Transduction Particles
thymine-DNA glycosylase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172552.1-1209s1c1
Sequence:CCGGGCATTGCTTCAAATGGGCTAACTCGAGTTAGCCCATTTGAAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172552.1-501s1c1
Sequence:CCGGCCAAGACTCTTCCTGACATTTCTCGAGAAATGTCAGGAAGAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172552.1-3001s1c1
Sequence:CCGGCCAGCAGGATTTAATGGTATTCTCGAGAATACCATTAAATCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172552.1-1108s1c1
Sequence:CCGGCGCAAAGAAGATGGCTGTTAACTCGAGTTAACAGCCATCTTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172552.1-808s1c1
Sequence:CCGGGCCACGAATAGCGGTGTTTAACTCGAGTTAAACACCGCTATTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172552.3-1131s21c1
Sequence:CCGGACGTTCAGGAAGTGCAGTATACTCGAGTATACTGCACTTCCTGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172552.3-809s21c1
Sequence:CCGGAGCAAGGATCTGTCTAGTAAACTCGAGTTTACTAGACAGATCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks