EMAIL THIS PAGE TO A FRIEND

TDGF1

teratocarcinoma-derived growth factor 1

Synonyms: CR CRGF CRIPTO
UniProtKB ID: P13385, Q8TCC1
Gene ID:
Human(6997) Summary: This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(21667) teratocarcinoma-derived growth factor 1
Rat(680246) teratocarcinoma-derived growth factor 1
cow(784029) teratocarcinoma-derived growth factor 1
naked mole-rat(101721157) teratocarcinoma-derived growth factor 1
dog(482156) teratocarcinoma-derived growth factor 1
domestic cat(101093999) teratocarcinoma-derived growth factor 1
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
SRP6009 TDGF1 human recombinant, expressed in HEK 293 F cells, ≥95% (SDS-PAGE) human pricing

ELISA

Product # Description Species Add to Cart
 
RAB0644 Human TDGF1 / Teratocarcinoma-derived Growth Factor 1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003212 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001056317 Rosetta Predictions rat pricing
NM_011562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282900 predicted 271
2 SASI_Rn02_00282901 predicted 230
3 SASI_Rn02_00282902 predicted 234
4 SASI_Rn02_00282903 predicted 257
5 SASI_Rn02_00282904 predicted 272
6 SASI_Rn02_00282905 predicted 268
7 SASI_Rn02_00282906 predicted 273
8 SASI_Rn02_00282907 predicted 283
9 SASI_Rn02_00282908 predicted 284
10 SASI_Rn02_00282909 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127342 predicted 344
2 SASI_Mm02_00320925 predicted 825
3 SASI_Mm02_00320926 predicted 1032
4 SASI_Mm02_00320927 predicted 825
5 SASI_Mm01_00127344 predicted 992
6 SASI_Mm01_00127345 predicted 575
7 SASI_Mm01_00127346 predicted 358
8 SASI_Mm01_00127347 predicted 990
9 SASI_Mm02_00320928 predicted 384
10 SASI_Mm02_00320929 predicted 605
11 SASI_Mm01_00127343 predicted 734
12 SASI_Mm01_00127348 predicted 774
13 SASI_Mm01_00127349 predicted 829
14 SASI_Mm01_00127350 predicted 313
15 SASI_Mm01_00127351 predicted 331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003212
TDGF1 MISSION shRNA Bacterial Glycerol Stock
teratocarcinoma-derived growth factor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003212.2-657s21c1
Sequence:CCGGAGAAGTGTTCCCTGTGTAAATCTCGAGATTTACACAGGGAACACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003212.2-1256s21c1
Sequence:CCGGGTCACCATGCCCAGCTAATTTCTCGAGAAATTAGCTGGGCATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003212.1-1706s1c1
Sequence:CCGGGCTAAATGGAAGGGCAAGTTTCTCGAGAAACTTGCCCTTCCATTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003212.1-463s1c1
Sequence:CCGGACAGCACAGTAAGGAGCTAAACTCGAGTTTAGCTCCTTACTGTGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003212.1-790s1c1
Sequence:CCGGCCTTTCTATACAAAGCTACTACTCGAGTAGTAGCTTTGTATAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003212.1-311s1c1
Sequence:CCGGGTCTTTGAACTGGGATTAGTTCTCGAGAACTAATCCCAGTTCAAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003212.1-751s1c1
Sequence:CCGGGTCTGCACGTACTACCACTTTCTCGAGAAAGTGGTAGTACGTGCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003212
TDGF1 MISSION shRNA shRNA Plasmid DNA
teratocarcinoma-derived growth factor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003212.2-657s21c1
Sequence:CCGGAGAAGTGTTCCCTGTGTAAATCTCGAGATTTACACAGGGAACACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003212.2-1256s21c1
Sequence:CCGGGTCACCATGCCCAGCTAATTTCTCGAGAAATTAGCTGGGCATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003212.1-1706s1c1
Sequence:CCGGGCTAAATGGAAGGGCAAGTTTCTCGAGAAACTTGCCCTTCCATTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003212.1-463s1c1
Sequence:CCGGACAGCACAGTAAGGAGCTAAACTCGAGTTTAGCTCCTTACTGTGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003212.1-790s1c1
Sequence:CCGGCCTTTCTATACAAAGCTACTACTCGAGTAGTAGCTTTGTATAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003212.1-311s1c1
Sequence:CCGGGTCTTTGAACTGGGATTAGTTCTCGAGAACTAATCCCAGTTCAAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003212.1-751s1c1
Sequence:CCGGGTCTGCACGTACTACCACTTTCTCGAGAAAGTGGTAGTACGTGCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003212
TDGF1 MISSION shRNA Lentiviral Transduction Particles
teratocarcinoma-derived growth factor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003212.2-657s21c1
Sequence:CCGGAGAAGTGTTCCCTGTGTAAATCTCGAGATTTACACAGGGAACACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003212.2-1256s21c1
Sequence:CCGGGTCACCATGCCCAGCTAATTTCTCGAGAAATTAGCTGGGCATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003212.1-1706s1c1
Sequence:CCGGGCTAAATGGAAGGGCAAGTTTCTCGAGAAACTTGCCCTTCCATTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003212.1-463s1c1
Sequence:CCGGACAGCACAGTAAGGAGCTAAACTCGAGTTTAGCTCCTTACTGTGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003212.1-790s1c1
Sequence:CCGGCCTTTCTATACAAAGCTACTACTCGAGTAGTAGCTTTGTATAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003212.1-311s1c1
Sequence:CCGGGTCTTTGAACTGGGATTAGTTCTCGAGAACTAATCCCAGTTCAAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003212.1-751s1c1
Sequence:CCGGGTCTGCACGTACTACCACTTTCTCGAGAAAGTGGTAGTACGTGCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011562
TDGF1 MISSION shRNA Bacterial Glycerol Stock
teratocarcinoma-derived growth factor 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000089293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011562.1-905s1c1
Sequence:CCGGCGAGTTACATTCCTAGCCTAACTCGAGTTAGGCTAGGAATGTAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011562.1-273s1c1
Sequence:CCGGGCGTTTGAATTTGGACCCGTTCTCGAGAACGGGTCCAAATTCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011562.1-263s1c1
Sequence:CCGGCATTTCCAGTGCGTTTGAATTCTCGAGAATTCAAACGCACTGGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011562.1-677s1c1
Sequence:CCGGGCCGTCTGTGACGACCACTTTCTCGAGAAAGTGGTCGTCACAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011562
TDGF1 MISSION shRNA shRNA Plasmid DNA
teratocarcinoma-derived growth factor 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000089293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011562.1-905s1c1
Sequence:CCGGCGAGTTACATTCCTAGCCTAACTCGAGTTAGGCTAGGAATGTAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011562.1-273s1c1
Sequence:CCGGGCGTTTGAATTTGGACCCGTTCTCGAGAACGGGTCCAAATTCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011562.1-263s1c1
Sequence:CCGGCATTTCCAGTGCGTTTGAATTCTCGAGAATTCAAACGCACTGGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011562.1-677s1c1
Sequence:CCGGGCCGTCTGTGACGACCACTTTCTCGAGAAAGTGGTCGTCACAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011562
TDGF1 MISSION shRNA Lentiviral Transduction Particles
teratocarcinoma-derived growth factor 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000089293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011562.1-905s1c1
Sequence:CCGGCGAGTTACATTCCTAGCCTAACTCGAGTTAGGCTAGGAATGTAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011562.1-273s1c1
Sequence:CCGGGCGTTTGAATTTGGACCCGTTCTCGAGAACGGGTCCAAATTCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011562.1-263s1c1
Sequence:CCGGCATTTCCAGTGCGTTTGAATTCTCGAGAATTCAAACGCACTGGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011562.1-677s1c1
Sequence:CCGGGCCGTCTGTGACGACCACTTTCTCGAGAAAGTGGTCGTCACAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks