EMAIL THIS PAGE TO A FRIEND

TDH

L-threonine dehydrogenase

Synonyms: SDR14E1P
UniProtKB ID: Q8IZJ6, Q8IZJ5, Q96LV6
Gene ID:
Mouse(58865) L-threonine dehydrogenase
Rat(290315) L-threonine dehydrogenase
Zebrafish(406528) L-threonine dehydrogenase
chicken(422034) L-threonine dehydrogenase
cow(511957) L-threonine dehydrogenase
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU187331 MISSION® esiRNA esiRNA targeting mouse Tdh mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_001578 Rosetta Predictions human pricing
NM_001106044 Rosetta Predictions rat pricing
NM_021480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_001578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00375220 predicted 863
2 SASI_Hs02_00375221 predicted 450
3 SASI_Hs02_00375222 predicted 565
4 SASI_Hs02_00375223 predicted 399
5 SASI_Hs02_00375224 predicted 516
6 SASI_Hs02_00375225 predicted 695
7 SASI_Hs02_00375226 predicted 732
8 SASI_Hs02_00375227 predicted 1051
9 SASI_Hs02_00375228 predicted 1067
10 SASI_Hs02_00375229 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215072 predicted 437
2 SASI_Rn02_00215073 predicted 535
3 SASI_Rn02_00215074 predicted 553
4 SASI_Rn02_00215075 predicted 1282
5 SASI_Rn02_00215076 predicted 812
6 SASI_Rn02_00215077 predicted 729
7 SASI_Rn02_00215078 predicted 1188
8 SASI_Rn02_00215079 predicted 699
9 SASI_Rn02_00215080 predicted 529
10 SASI_Rn02_00215081 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054496 predicted 867
2 SASI_Mm02_00326164 predicted 746
3 SASI_Mm01_00054497 predicted 1282
4 SASI_Mm01_00054498 predicted 849
5 SASI_Mm01_00054500 predicted 1344
6 SASI_Mm01_00054501 predicted 873
7 SASI_Mm01_00054502 predicted 1069
8 SASI_Mm01_00054503 predicted 1076
9 SASI_Mm01_00054504 predicted 1200
10 SASI_Mm01_00054505 predicted 857
11 SASI_Mm01_00054499 predicted 1408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021480
TDH MISSION shRNA Bacterial Glycerol Stock
L-threonine dehydrogenase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021480.4-1664s1c1
Sequence:CCGGGCCTTTGTCCTGTGCCTAAATCTCGAGATTTAGGCACAGGACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021480.4-1071s1c1
Sequence:CCGGCCTGCGTTATCCTGGAATCATCTCGAGATGATTCCAGGATAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021480.4-836s1c1
Sequence:CCGGCCTTAGCCAGAGATGTGAATACTCGAGTATTCACATCTCTGGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021480.4-961s1c1
Sequence:CCGGGCACCCGATCTCTGTATTCAACTCGAGTTGAATACAGAGATCGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021480.4-714s1c1
Sequence:CCGGCCCGTTTGTTTATGCCAACATCTCGAGATGTTGGCATAAACAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021480.5-1765s21c1
Sequence:CCGGGTATCACTCCTGAGACTTATTCTCGAGAATAAGTCTCAGGAGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021480.5-847s21c1
Sequence:CCGGGGATTGCATAACGTTCTAGATCTCGAGATCTAGAACGTTATGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021480
TDH MISSION shRNA shRNA Plasmid DNA
L-threonine dehydrogenase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021480.4-1664s1c1
Sequence:CCGGGCCTTTGTCCTGTGCCTAAATCTCGAGATTTAGGCACAGGACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021480.4-1071s1c1
Sequence:CCGGCCTGCGTTATCCTGGAATCATCTCGAGATGATTCCAGGATAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021480.4-836s1c1
Sequence:CCGGCCTTAGCCAGAGATGTGAATACTCGAGTATTCACATCTCTGGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021480.4-961s1c1
Sequence:CCGGGCACCCGATCTCTGTATTCAACTCGAGTTGAATACAGAGATCGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021480.4-714s1c1
Sequence:CCGGCCCGTTTGTTTATGCCAACATCTCGAGATGTTGGCATAAACAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021480.5-1765s21c1
Sequence:CCGGGTATCACTCCTGAGACTTATTCTCGAGAATAAGTCTCAGGAGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021480.5-847s21c1
Sequence:CCGGGGATTGCATAACGTTCTAGATCTCGAGATCTAGAACGTTATGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021480
TDH MISSION shRNA Lentiviral Transduction Particles
L-threonine dehydrogenase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021480.4-1664s1c1
Sequence:CCGGGCCTTTGTCCTGTGCCTAAATCTCGAGATTTAGGCACAGGACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021480.4-1071s1c1
Sequence:CCGGCCTGCGTTATCCTGGAATCATCTCGAGATGATTCCAGGATAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021480.4-836s1c1
Sequence:CCGGCCTTAGCCAGAGATGTGAATACTCGAGTATTCACATCTCTGGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021480.4-961s1c1
Sequence:CCGGGCACCCGATCTCTGTATTCAACTCGAGTTGAATACAGAGATCGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021480.4-714s1c1
Sequence:CCGGCCCGTTTGTTTATGCCAACATCTCGAGATGTTGGCATAAACAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021480.5-1765s21c1
Sequence:CCGGGTATCACTCCTGAGACTTATTCTCGAGAATAAGTCTCAGGAGTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021480.5-847s21c1
Sequence:CCGGGGATTGCATAACGTTCTAGATCTCGAGATCTAGAACGTTATGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks