EMAIL THIS PAGE TO A FRIEND

TDO2

tryptophan 2,3-dioxygenase

Synonyms: TDO TO TPH2 TRPO
UniProtKB ID: P48775, A8K053
Gene ID:
Human(6999) Summary: This gene encodes a heme enzyme that plays a critical role in tryptophan metabolism by catalyzing the first and rate-limiting step of the kynurenine pathway. Increased activity of the encoded protein and subsequent kynurenine production may also play a role in cancer through the suppression of antitumor immune responses, and single nucleotide polymorphisms in this gene may be associated with autism. [provided by RefSeq, Feb 2012]
Mouse(56720) tryptophan 2,3-dioxygenase
Rat(64206) tryptophan 2,3-dioxygenase
cow(530397) tryptophan 2,3-dioxygenase
sheep(101109739) tryptophan 2,3-dioxygenase
domestic guinea pig(100727713) tryptophan 2,3-dioxygenase
naked mole-rat(101711781) tryptophan 2,3-dioxygenase
Domestic Rabbit(100344083) tryptophan 2,3-dioxygenase
chicken(422409) tryptophan 2,3-dioxygenase
dog(475476) tryptophan 2,3-dioxygenase
Horse(100069524) tryptophan 2,3-dioxygenase
domestic cat(101090935) tryptophan 2,3-dioxygenase
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Precursor

Product # Description Species Add to Cart
 
T0254 L-Tryptophan reagent grade, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005651 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012871 MISSION® esiRNA esiRNA targeting human TDO2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005651 Rosetta Predictions human pricing
NM_022403 Rosetta Predictions rat pricing
NM_019911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063049 predicted 1263
2 SASI_Hs01_00063051 predicted 292
3 SASI_Hs02_00340017 predicted 480
4 SASI_Hs02_00340018 predicted 520
5 SASI_Hs01_00063052 predicted 223
6 SASI_Hs01_00063053 predicted 700
7 SASI_Hs01_00063055 predicted 1003
8 SASI_Hs01_00063056 predicted 489
9 SASI_Hs01_00063057 predicted 920
10 SASI_Hs02_00340019 predicted 328
11 SASI_Hs01_00063048 predicted 1154
12 SASI_Hs01_00063050 predicted 1208
13 SASI_Hs01_00063054 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106823 predicted 1072
2 SASI_Rn01_00106824 predicted 270
3 SASI_Rn01_00106825 predicted 551
4 SASI_Rn01_00106826 predicted 351
5 SASI_Rn01_00106827 predicted 996
6 SASI_Rn02_00263177 predicted 1324
7 SASI_Rn01_00106829 predicted 1185
8 SASI_Rn02_00263178 predicted 1190
9 SASI_Rn01_00106830 predicted 867
10 SASI_Rn01_00106831 predicted 855
11 SASI_Rn01_00106828 predicted 443
12 SASI_Rn01_00106832 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049122 predicted 551
2 SASI_Mm02_00325189 predicted 991
3 SASI_Mm01_00049123 predicted 1313
4 SASI_Mm01_00049124 predicted 1179
5 SASI_Mm01_00049125 predicted 293
6 SASI_Mm01_00049127 predicted 1222
7 SASI_Mm01_00049128 predicted 860
8 SASI_Mm01_00049129 predicted 844
9 SASI_Mm01_00049130 predicted 248
10 SASI_Mm01_00049131 predicted 658
11 SASI_Mm01_00049126 predicted 996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005651
TDO2 MISSION shRNA Bacterial Glycerol Stock
tryptophan 2,3-dioxygenase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005651.2-1130s21c1
Sequence:CCGGAGTGATAGGTACAAGGTATTTCTCGAGAAATACCTTGTACCTATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005651.2-1024s21c1
Sequence:CCGGGATGACCAAATGGAGATATAACTCGAGTTATATCTCCATTTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005651.2-382s21c1
Sequence:CCGGGAACATGCTTAAGGTTGTTTCCTCGAGGAAACAACCTTAAGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005651.2-281s21c1
Sequence:CCGGATCATAACTCATCAAGCTTATCTCGAGATAAGCTTGATGAGTTATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-224s1c1
Sequence:CCGGGCACAAGAACTGCAAAGTGAACTCGAGTTCACTTTGCAGTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-1104s1c1
Sequence:CCGGGCTATCACTACCTGCGATCAACTCGAGTTGATCGCAGGTAGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-413s1c1
Sequence:CCGGCGAGTGTCAGTGATCCTGAAACTCGAGTTTCAGGATCACTGACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-605s1c1
Sequence:CCGGCGTGATAACTTCAAAGGAGAACTCGAGTTCTCCTTTGAAGTTATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-688s1c1
Sequence:CCGGGCTGGAAAGAACTCCAGGTTTCTCGAGAAACCTGGAGTTCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005651
TDO2 MISSION shRNA shRNA Plasmid DNA
tryptophan 2,3-dioxygenase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005651.2-1130s21c1
Sequence:CCGGAGTGATAGGTACAAGGTATTTCTCGAGAAATACCTTGTACCTATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005651.2-1024s21c1
Sequence:CCGGGATGACCAAATGGAGATATAACTCGAGTTATATCTCCATTTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005651.2-382s21c1
Sequence:CCGGGAACATGCTTAAGGTTGTTTCCTCGAGGAAACAACCTTAAGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005651.2-281s21c1
Sequence:CCGGATCATAACTCATCAAGCTTATCTCGAGATAAGCTTGATGAGTTATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-224s1c1
Sequence:CCGGGCACAAGAACTGCAAAGTGAACTCGAGTTCACTTTGCAGTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-1104s1c1
Sequence:CCGGGCTATCACTACCTGCGATCAACTCGAGTTGATCGCAGGTAGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-413s1c1
Sequence:CCGGCGAGTGTCAGTGATCCTGAAACTCGAGTTTCAGGATCACTGACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-605s1c1
Sequence:CCGGCGTGATAACTTCAAAGGAGAACTCGAGTTCTCCTTTGAAGTTATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-688s1c1
Sequence:CCGGGCTGGAAAGAACTCCAGGTTTCTCGAGAAACCTGGAGTTCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005651
TDO2 MISSION shRNA Lentiviral Transduction Particles
tryptophan 2,3-dioxygenase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005651.2-1130s21c1
Sequence:CCGGAGTGATAGGTACAAGGTATTTCTCGAGAAATACCTTGTACCTATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005651.2-1024s21c1
Sequence:CCGGGATGACCAAATGGAGATATAACTCGAGTTATATCTCCATTTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005651.2-382s21c1
Sequence:CCGGGAACATGCTTAAGGTTGTTTCCTCGAGGAAACAACCTTAAGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005651.2-281s21c1
Sequence:CCGGATCATAACTCATCAAGCTTATCTCGAGATAAGCTTGATGAGTTATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-224s1c1
Sequence:CCGGGCACAAGAACTGCAAAGTGAACTCGAGTTCACTTTGCAGTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-1104s1c1
Sequence:CCGGGCTATCACTACCTGCGATCAACTCGAGTTGATCGCAGGTAGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-413s1c1
Sequence:CCGGCGAGTGTCAGTGATCCTGAAACTCGAGTTTCAGGATCACTGACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-605s1c1
Sequence:CCGGCGTGATAACTTCAAAGGAGAACTCGAGTTCTCCTTTGAAGTTATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005651.1-688s1c1
Sequence:CCGGGCTGGAAAGAACTCCAGGTTTCTCGAGAAACCTGGAGTTCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019911
TDO2 MISSION shRNA Bacterial Glycerol Stock
tryptophan 2,3-dioxygenase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019911.2-1416s1c1
Sequence:CCGGGTGAGCGATTAGGAGGATTAACTCGAGTTAATCCTCCTAATCGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019911.2-1170s1c1
Sequence:CCGGCCAAAGATGAATCCGATCATTCTCGAGAATGATCGGATTCATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019911.2-195s1c1
Sequence:CCGGGCGCAAGAACTTCAGAGTGAACTCGAGTTCACTCTGAAGTTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019911.2-659s1c1
Sequence:CCGGGCTGGAAAGAACACCTGGTTTCTCGAGAAACCAGGTGTTCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019911.2-733s1c1
Sequence:CCGGGCCTGGAAGAAGAATTTCTAACTCGAGTTAGAAATTCTTCTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019911
TDO2 MISSION shRNA shRNA Plasmid DNA
tryptophan 2,3-dioxygenase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019911.2-1416s1c1
Sequence:CCGGGTGAGCGATTAGGAGGATTAACTCGAGTTAATCCTCCTAATCGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019911.2-1170s1c1
Sequence:CCGGCCAAAGATGAATCCGATCATTCTCGAGAATGATCGGATTCATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019911.2-195s1c1
Sequence:CCGGGCGCAAGAACTTCAGAGTGAACTCGAGTTCACTCTGAAGTTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019911.2-659s1c1
Sequence:CCGGGCTGGAAAGAACACCTGGTTTCTCGAGAAACCAGGTGTTCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019911.2-733s1c1
Sequence:CCGGGCCTGGAAGAAGAATTTCTAACTCGAGTTAGAAATTCTTCTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019911
TDO2 MISSION shRNA Lentiviral Transduction Particles
tryptophan 2,3-dioxygenase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019911.2-1416s1c1
Sequence:CCGGGTGAGCGATTAGGAGGATTAACTCGAGTTAATCCTCCTAATCGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019911.2-1170s1c1
Sequence:CCGGCCAAAGATGAATCCGATCATTCTCGAGAATGATCGGATTCATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019911.2-195s1c1
Sequence:CCGGGCGCAAGAACTTCAGAGTGAACTCGAGTTCACTCTGAAGTTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019911.2-659s1c1
Sequence:CCGGGCTGGAAAGAACACCTGGTTTCTCGAGAAACCAGGTGTTCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019911.2-733s1c1
Sequence:CCGGGCCTGGAAGAAGAATTTCTAACTCGAGTTAGAAATTCTTCTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks