EMAIL THIS PAGE TO A FRIEND

TDP1

tyrosyl-DNA phosphodiesterase 1

UniProtKB ID: Q9NUW8, Q2HXX4, Q96BK7, Q9NZM7, Q9NZM8
Gene ID:
Human(55775) Summary: The protein encoded by this gene is involved in repairing stalled topoisomerase I-DNA complexes by catalyzing the hydrolysis of the phosphodiester bond between the tyrosine residue of topoisomerase I and the 3-prime phosphate of DNA. This protein may also remove glycolate from single-stranded DNA containing 3-prime phosphoglycolate, suggesting a role in repair of free-radical mediated DNA double-strand breaks. This gene is a member of the phospholipase D family and contains two PLD phosphodiesterase domains. Mutations in this gene are associated with the disease spinocerebellar ataxia with axonal neuropathy (SCAN1). While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode the same isoform. [provided by RefSeq, Jul 2008]
Mouse(104884) tyrosyl-DNA phosphodiesterase 1
Rat(314380) tyrosyl-DNA phosphodiesterase 1
Thale Cress(831369) tyrosyl-DNA phosphodiesterase 1
Horse(100062463) tyrosyl-DNA phosphodiesterase 1
domestic cat(101093528) tyrosyl-DNA phosphodiesterase 1
dog(490828) tyrosyl-DNA phosphodiesterase 1
chicken(423403) tyrosyl-DNA phosphodiesterase 1
Zebrafish(571485) tyrosyl-DNA phosphodiesterase 1
Domestic Rabbit(100349532) tyrosyl-DNA phosphodiesterase 1
naked mole-rat(101712310) tyrosyl-DNA phosphodiesterase 1
domestic guinea pig(100724667) tyrosyl-DNA phosphodiesterase 1
cow(517053) tyrosyl-DNA phosphodiesterase 1
sheep(101119906) tyrosyl-DNA phosphodiesterase 1
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028354 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028354 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028354 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018319 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008744 Rosetta Predictions human pricing
NM_018319 Rosetta Predictions human pricing
NM_001031657 Rosetta Predictions rat pricing
NM_028354 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172342 predicted 1285
2 SASI_Hs01_00172344 predicted 1307
3 SASI_Hs02_00305555 predicted 1714
4 SASI_Hs01_00172347 predicted 1034
5 SASI_Hs01_00172348 predicted 1782
6 SASI_Hs01_00172349 predicted 730
7 SASI_Hs01_00172351 predicted 1505
8 SASI_Hs02_00305556 predicted 1820
9 SASI_Hs02_00305557 predicted 759
10 SASI_Hs02_00305558 predicted 971
11 SASI_Hs01_00172343 predicted 1556
12 SASI_Hs01_00172345 predicted 1928
13 SASI_Hs01_00172346 predicted 1050
14 SASI_Hs01_00172350 predicted 1907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239046 predicted 1513
2 SASI_Hs01_00239048 predicted 1523
3 SASI_Hs02_00351745 predicted 1930
4 SASI_Hs01_00239051 predicted 1253
5 SASI_Hs01_00239052 predicted 1997
6 SASI_Hs01_00239053 predicted 952
7 SASI_Hs01_00239055 predicted 1724
8 SASI_Hs02_00351746 predicted 2040
9 SASI_Hs02_00351747 predicted 983
10 SASI_Hs02_00351748 predicted 1191
11 SASI_Hs01_00239047 predicted 1770
12 SASI_Hs01_00239049 predicted 2152
13 SASI_Hs01_00239050 predicted 1266
14 SASI_Hs01_00239054 predicted 2129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081225 predicted 895
2 SASI_Rn01_00081226 predicted 1226
3 SASI_Rn01_00081227 predicted 987
4 SASI_Rn01_00081228 predicted 628
5 SASI_Rn02_00203602 predicted 1043
6 SASI_Rn01_00081229 predicted 1776
7 SASI_Rn01_00081230 predicted 1486
8 SASI_Rn01_00081231 predicted 1024
9 SASI_Rn01_00081232 predicted 598
10 SASI_Rn01_00081233 predicted 1457
11 SASI_Rn01_00081234 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200940 predicted 1485
2 SASI_Mm01_00200942 predicted 1524
3 SASI_Mm01_00200943 predicted 981
4 SASI_Mm01_00200944 predicted 1015
5 SASI_Mm02_00333726 predicted 1804
6 SASI_Mm01_00200947 predicted 621
7 SASI_Mm01_00200948 predicted 1506
8 SASI_Mm01_00200949 predicted 1478
9 SASI_Mm02_00333727 predicted 802
10 SASI_Mm02_00333728 predicted 753
11 SASI_Mm01_00200941 predicted 1838
12 SASI_Mm01_00200945 predicted 1879
13 SASI_Mm01_00200946 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028354
VALIDATED
TDP1 MISSION shRNA Bacterial Glycerol Stock
tyrosyl-DNA phosphodiesterase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028354.1-417s1c1
Sequence:CCGGCCCAGAAAGTTGTGGATAGAACTCGAGTTCTATCCACAACTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028354.1-2923s1c1
Sequence:CCGGGCTCAGATATTTGCTGTGATTCTCGAGAATCACAGCAAATATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028354.1-771s1c1
Sequence:CCGGCGAAGCCCTATGCGAACATTTCTCGAGAAATGTTCGCATAGGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028354.4-720s21c1
Sequence:CCGGCCTGCTTGTGCACGGTGATAACTCGAGTTATCACCGTGCACAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028354.4-163s21c1
Sequence:CCGGGTGTCGAAGGAGCTCATATACCTCGAGGTATATGAGCTCCTTCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028354.4-1900s21c1
Sequence:CCGGTAAAGTCCTGCACCCGTACAGCTCGAGCTGTACGGGTGCAGGACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028354.4-773s21c1
Sequence:CCGGCGAAGCCCTATGCGAACATTTCTCGAGAAATGTTCGCATAGGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028354.4-1020s21c1
Sequence:CCGGCAGTTATCTAACGGCGTATAACTCGAGTTATACGCCGTTAGATAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028354
VALIDATED
TDP1 MISSION shRNA shRNA Plasmid DNA
tyrosyl-DNA phosphodiesterase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028354.1-417s1c1
Sequence:CCGGCCCAGAAAGTTGTGGATAGAACTCGAGTTCTATCCACAACTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028354.1-2923s1c1
Sequence:CCGGGCTCAGATATTTGCTGTGATTCTCGAGAATCACAGCAAATATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028354.1-771s1c1
Sequence:CCGGCGAAGCCCTATGCGAACATTTCTCGAGAAATGTTCGCATAGGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028354.4-720s21c1
Sequence:CCGGCCTGCTTGTGCACGGTGATAACTCGAGTTATCACCGTGCACAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028354.4-163s21c1
Sequence:CCGGGTGTCGAAGGAGCTCATATACCTCGAGGTATATGAGCTCCTTCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028354.4-1900s21c1
Sequence:CCGGTAAAGTCCTGCACCCGTACAGCTCGAGCTGTACGGGTGCAGGACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028354.4-773s21c1
Sequence:CCGGCGAAGCCCTATGCGAACATTTCTCGAGAAATGTTCGCATAGGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028354.4-1020s21c1
Sequence:CCGGCAGTTATCTAACGGCGTATAACTCGAGTTATACGCCGTTAGATAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028354
VALIDATED
TDP1 MISSION shRNA Lentiviral Transduction Particles
tyrosyl-DNA phosphodiesterase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028354.1-417s1c1
Sequence:CCGGCCCAGAAAGTTGTGGATAGAACTCGAGTTCTATCCACAACTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028354.1-2923s1c1
Sequence:CCGGGCTCAGATATTTGCTGTGATTCTCGAGAATCACAGCAAATATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028354.1-771s1c1
Sequence:CCGGCGAAGCCCTATGCGAACATTTCTCGAGAAATGTTCGCATAGGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028354.4-720s21c1
Sequence:CCGGCCTGCTTGTGCACGGTGATAACTCGAGTTATCACCGTGCACAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028354.4-163s21c1
Sequence:CCGGGTGTCGAAGGAGCTCATATACCTCGAGGTATATGAGCTCCTTCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028354.4-1900s21c1
Sequence:CCGGTAAAGTCCTGCACCCGTACAGCTCGAGCTGTACGGGTGCAGGACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028354.4-773s21c1
Sequence:CCGGCGAAGCCCTATGCGAACATTTCTCGAGAAATGTTCGCATAGGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028354.4-1020s21c1
Sequence:CCGGCAGTTATCTAACGGCGTATAACTCGAGTTATACGCCGTTAGATAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018319
VALIDATED
TDP1 MISSION shRNA Bacterial Glycerol Stock
tyrosyl-DNA phosphodiesterase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018319.2-1467s1c1
Sequence:CCGGCCGATGAATCAAAGTGGTTATCTCGAGATAACCACTTTGATTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018319.2-2027s1c1
Sequence:CCGGCCTTATGTCAAAGCACCGGATCTCGAGATCCGGTGCTTTGACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018319.2-1591s1c1
Sequence:CCGGGCGGACCAGTTTAGAAGGATACTCGAGTATCCTTCTAAACTGGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018319.2-1282s1c1
Sequence:CCGGGCACGATCTCTCTGAAACAAACTCGAGTTTGTTTCAGAGAGATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018319.2-282s1c1
Sequence:CCGGCCATATCTAGTAGTGATGAAACTCGAGTTTCATCACTACTAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018319.3-1272s21c1
Sequence:CCGGAGTTACTTGATGGCTTATAATCTCGAGATTATAAGCCATCAAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018319.3-2203s21c1
Sequence:CCGGCCACTTCCCTTAAAGTCTTATCTCGAGATAAGACTTTAAGGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018319.3-1516s21c1
Sequence:CCGGCCGATGAATCAAAGTGGTTATCTCGAGATAACCACTTTGATTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018319.3-1331s21c1
Sequence:CCGGGCACGATCTCTCTGAAACAAACTCGAGTTTGTTTCAGAGAGATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018319.3-1640s21c1
Sequence:CCGGGCGGACCAGTTTAGAAGGATACTCGAGTATCCTTCTAAACTGGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018319
VALIDATED
TDP1 MISSION shRNA shRNA Plasmid DNA
tyrosyl-DNA phosphodiesterase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018319.2-1467s1c1
Sequence:CCGGCCGATGAATCAAAGTGGTTATCTCGAGATAACCACTTTGATTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018319.2-2027s1c1
Sequence:CCGGCCTTATGTCAAAGCACCGGATCTCGAGATCCGGTGCTTTGACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018319.2-1591s1c1
Sequence:CCGGGCGGACCAGTTTAGAAGGATACTCGAGTATCCTTCTAAACTGGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018319.2-1282s1c1
Sequence:CCGGGCACGATCTCTCTGAAACAAACTCGAGTTTGTTTCAGAGAGATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018319.2-282s1c1
Sequence:CCGGCCATATCTAGTAGTGATGAAACTCGAGTTTCATCACTACTAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018319.3-1272s21c1
Sequence:CCGGAGTTACTTGATGGCTTATAATCTCGAGATTATAAGCCATCAAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018319.3-2203s21c1
Sequence:CCGGCCACTTCCCTTAAAGTCTTATCTCGAGATAAGACTTTAAGGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018319.3-1516s21c1
Sequence:CCGGCCGATGAATCAAAGTGGTTATCTCGAGATAACCACTTTGATTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018319.3-1331s21c1
Sequence:CCGGGCACGATCTCTCTGAAACAAACTCGAGTTTGTTTCAGAGAGATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018319.3-1640s21c1
Sequence:CCGGGCGGACCAGTTTAGAAGGATACTCGAGTATCCTTCTAAACTGGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018319
VALIDATED
TDP1 MISSION shRNA Lentiviral Transduction Particles
tyrosyl-DNA phosphodiesterase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018319.2-1467s1c1
Sequence:CCGGCCGATGAATCAAAGTGGTTATCTCGAGATAACCACTTTGATTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018319.2-2027s1c1
Sequence:CCGGCCTTATGTCAAAGCACCGGATCTCGAGATCCGGTGCTTTGACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018319.2-1591s1c1
Sequence:CCGGGCGGACCAGTTTAGAAGGATACTCGAGTATCCTTCTAAACTGGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018319.2-1282s1c1
Sequence:CCGGGCACGATCTCTCTGAAACAAACTCGAGTTTGTTTCAGAGAGATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018319.2-282s1c1
Sequence:CCGGCCATATCTAGTAGTGATGAAACTCGAGTTTCATCACTACTAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018319.3-1272s21c1
Sequence:CCGGAGTTACTTGATGGCTTATAATCTCGAGATTATAAGCCATCAAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018319.3-2203s21c1
Sequence:CCGGCCACTTCCCTTAAAGTCTTATCTCGAGATAAGACTTTAAGGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018319.3-1516s21c1
Sequence:CCGGCCGATGAATCAAAGTGGTTATCTCGAGATAACCACTTTGATTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018319.3-1331s21c1
Sequence:CCGGGCACGATCTCTCTGAAACAAACTCGAGTTTGTTTCAGAGAGATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018319.3-1640s21c1
Sequence:CCGGGCGGACCAGTTTAGAAGGATACTCGAGTATCCTTCTAAACTGGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks