EMAIL THIS PAGE TO A FRIEND

TDP2

tyrosyl-DNA phosphodiesterase 2

Synonyms: AD022 EAP2 EAPII TTRAP dJ30M3.3 hTDP2
Gene ID:
Human(51567) Summary: This gene encodes a member of a superfamily of divalent cation-dependent phosphodiesterases. The encoded protein associates with CD40, tumor necrosis factor (TNF) receptor-75 and TNF receptor associated factors (TRAFs), and inhibits nuclear factor-kappa-B activation. This protein has sequence and structural similarities with APE1 endonuclease, which is involved in both DNA repair and the activation of transcription factors. [provided by RefSeq, Jul 2008]
Mouse(56196) tyrosyl-DNA phosphodiesterase 2
Rat(498749) tyrosyl-DNA phosphodiesterase 2
cow(507579) tyrosyl-DNA phosphodiesterase 2
sheep(101107315) tyrosyl-DNA phosphodiesterase 2
domestic guinea pig(100724093) tyrosyl-DNA phosphodiesterase 2
naked mole-rat(101721465) tyrosyl-DNA phosphodiesterase 2
chicken(421007) tyrosyl-DNA phosphodiesterase 2
dog(478737) tyrosyl-DNA phosphodiesterase 2
domestic cat(101087739) tyrosyl-DNA phosphodiesterase 2
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016614 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051491 MISSION® esiRNA esiRNA targeting mouse Ttrap (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016614 Rosetta Predictions human pricing
NM_001034947 Rosetta Predictions rat pricing
NM_019551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012111 predicted 272
2 SASI_Hs01_00012112 predicted 530
3 SASI_Hs01_00012113 predicted 900
4 SASI_Hs01_00012115 predicted 937
5 SASI_Hs02_00349764 predicted 895
6 SASI_Hs02_00349765 predicted 669
7 SASI_Hs01_00012116 predicted 376
8 SASI_Hs01_00012117 predicted 433
9 SASI_Hs02_00349766 predicted 421
10 SASI_Hs01_00012120 predicted 246
11 SASI_Hs01_00012114 predicted 1207
12 SASI_Hs01_00012118 predicted 991
13 SASI_Hs01_00012119 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068653 predicted 591
2 SASI_Rn01_00068654 predicted 959
3 SASI_Rn01_00068655 predicted 786
4 SASI_Rn01_00068656 predicted 836
5 SASI_Rn01_00068657 predicted 580
6 SASI_Rn01_00068658 predicted 1237
7 SASI_Rn02_00204134 predicted 906
8 SASI_Rn01_00068660 predicted 226
9 SASI_Rn01_00068661 predicted 608
10 SASI_Rn01_00068662 predicted 1226
11 SASI_Rn01_00068659 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136347 predicted 824
2 SASI_Mm01_00136348 predicted 954
3 SASI_Mm01_00136349 predicted 965
4 SASI_Mm01_00136350 predicted 566
5 SASI_Mm01_00136351 predicted 898
6 SASI_Mm01_00136352 predicted 1241
7 SASI_Mm01_00136353 predicted 1225
8 SASI_Mm01_00136354 predicted 474
9 SASI_Mm01_00136355 predicted 770
10 SASI_Mm01_00136356 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019551
VALIDATED
TDP2 MISSION shRNA Bacterial Glycerol Stock
tyrosyl-DNA phosphodiesterase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019551.1-542s21c1
Sequence:CCGGCCCATACTGTGCCTACCTAAACTCGAGTTTAGGTAGGCACAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019551.1-832s21c1
Sequence:CCGGCAGATTCAACCACGGTTATATCTCGAGATATAACCGTGGTTGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019551.1-773s21c1
Sequence:CCGGACATTCTGCGGAACGAATAAGCTCGAGCTTATTCGTTCCGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019551.1-694s21c1
Sequence:CCGGGAAACCTGCTATGCGTAAATGCTCGAGCATTTACGCATAGCAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019551.1-1589s21c1
Sequence:CCGGGCCGTGACCAACCGTAGTAAACTCGAGTTTACTACGGTTGGTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019551.1-441s1c1
Sequence:CCGGGATGGATTAGATGGATGCAATCTCGAGATTGCATCCATCTAATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019551.1-1620s1c1
Sequence:CCGGGCTGTTGTATATCAGACTTAACTCGAGTTAAGTCTGATATACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019551.1-1755s1c1
Sequence:CCGGGCAATGATTAAACCCAGCTTACTCGAGTAAGCTGGGTTTAATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019551.1-885s1c1
Sequence:CCGGGTTATCAAATGTGGTGGTTTACTCGAGTAAACCACCACATTTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019551
VALIDATED
TDP2 MISSION shRNA shRNA Plasmid DNA
tyrosyl-DNA phosphodiesterase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019551.1-542s21c1
Sequence:CCGGCCCATACTGTGCCTACCTAAACTCGAGTTTAGGTAGGCACAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019551.1-832s21c1
Sequence:CCGGCAGATTCAACCACGGTTATATCTCGAGATATAACCGTGGTTGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019551.1-773s21c1
Sequence:CCGGACATTCTGCGGAACGAATAAGCTCGAGCTTATTCGTTCCGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019551.1-694s21c1
Sequence:CCGGGAAACCTGCTATGCGTAAATGCTCGAGCATTTACGCATAGCAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019551.1-1589s21c1
Sequence:CCGGGCCGTGACCAACCGTAGTAAACTCGAGTTTACTACGGTTGGTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019551.1-441s1c1
Sequence:CCGGGATGGATTAGATGGATGCAATCTCGAGATTGCATCCATCTAATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019551.1-1620s1c1
Sequence:CCGGGCTGTTGTATATCAGACTTAACTCGAGTTAAGTCTGATATACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019551.1-1755s1c1
Sequence:CCGGGCAATGATTAAACCCAGCTTACTCGAGTAAGCTGGGTTTAATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019551.1-885s1c1
Sequence:CCGGGTTATCAAATGTGGTGGTTTACTCGAGTAAACCACCACATTTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019551
VALIDATED
TDP2 MISSION shRNA Lentiviral Transduction Particles
tyrosyl-DNA phosphodiesterase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019551.1-542s21c1
Sequence:CCGGCCCATACTGTGCCTACCTAAACTCGAGTTTAGGTAGGCACAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019551.1-832s21c1
Sequence:CCGGCAGATTCAACCACGGTTATATCTCGAGATATAACCGTGGTTGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019551.1-773s21c1
Sequence:CCGGACATTCTGCGGAACGAATAAGCTCGAGCTTATTCGTTCCGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019551.1-694s21c1
Sequence:CCGGGAAACCTGCTATGCGTAAATGCTCGAGCATTTACGCATAGCAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019551.1-1589s21c1
Sequence:CCGGGCCGTGACCAACCGTAGTAAACTCGAGTTTACTACGGTTGGTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019551.1-441s1c1
Sequence:CCGGGATGGATTAGATGGATGCAATCTCGAGATTGCATCCATCTAATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019551.1-1620s1c1
Sequence:CCGGGCTGTTGTATATCAGACTTAACTCGAGTTAAGTCTGATATACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019551.1-1755s1c1
Sequence:CCGGGCAATGATTAAACCCAGCTTACTCGAGTAAGCTGGGTTTAATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019551.1-885s1c1
Sequence:CCGGGTTATCAAATGTGGTGGTTTACTCGAGTAAACCACCACATTTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016614
TDP2 MISSION shRNA Bacterial Glycerol Stock
tyrosyl-DNA phosphodiesterase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016614.2-1564s21c1
Sequence:CCGGGCAGTTAAGTAGATGACAGCTCTCGAGAGCTGTCATCTACTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016614.2-300s21c1
Sequence:CCGGCAACTGATTCCACCACTTCTACTCGAGTAGAAGTGGTGGAATCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016614.2-490s21c1
Sequence:CCGGCCCATATTATAGCTACCTAAACTCGAGTTTAGGTAGCTATAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016614.2-553s21c1
Sequence:CCGGAGGATATTTCACAGCTATAATCTCGAGATTATAGCTGTGAAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016614.2-892s21c1
Sequence:CCGGACCTAAACATTGCCAGTATACCTCGAGGTATACTGGCAATGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016614.x-791s1c1
Sequence:CCGGACAGTTATATTTGCAGGAGATCTCGAGATCTCCTGCAAATATAACTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016614.x-300s1c1
Sequence:CCGGCAACTGATTCCACCACTTCTACTCGAGTAGAAGTGGTGGAATCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016614.x-505s1c1
Sequence:CCGGCCTAAAGAAGAGATCAAGTAACTCGAGTTACTTGATCTCTTCTTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016614.x-1564s1c1
Sequence:CCGGGCAGTTAAGTAGATGACAGCTCTCGAGAGCTGTCATCTACTTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016614.x-992s1c1
Sequence:CCGGGCAGCAGAAGAGGGACACATTCTCGAGAATGTGTCCCTCTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016614
TDP2 MISSION shRNA shRNA Plasmid DNA
tyrosyl-DNA phosphodiesterase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016614.2-1564s21c1
Sequence:CCGGGCAGTTAAGTAGATGACAGCTCTCGAGAGCTGTCATCTACTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016614.2-300s21c1
Sequence:CCGGCAACTGATTCCACCACTTCTACTCGAGTAGAAGTGGTGGAATCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016614.2-490s21c1
Sequence:CCGGCCCATATTATAGCTACCTAAACTCGAGTTTAGGTAGCTATAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016614.2-553s21c1
Sequence:CCGGAGGATATTTCACAGCTATAATCTCGAGATTATAGCTGTGAAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016614.2-892s21c1
Sequence:CCGGACCTAAACATTGCCAGTATACCTCGAGGTATACTGGCAATGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016614.x-791s1c1
Sequence:CCGGACAGTTATATTTGCAGGAGATCTCGAGATCTCCTGCAAATATAACTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016614.x-300s1c1
Sequence:CCGGCAACTGATTCCACCACTTCTACTCGAGTAGAAGTGGTGGAATCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016614.x-505s1c1
Sequence:CCGGCCTAAAGAAGAGATCAAGTAACTCGAGTTACTTGATCTCTTCTTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016614.x-1564s1c1
Sequence:CCGGGCAGTTAAGTAGATGACAGCTCTCGAGAGCTGTCATCTACTTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016614.x-992s1c1
Sequence:CCGGGCAGCAGAAGAGGGACACATTCTCGAGAATGTGTCCCTCTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016614
TDP2 MISSION shRNA Lentiviral Transduction Particles
tyrosyl-DNA phosphodiesterase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016614.2-1564s21c1
Sequence:CCGGGCAGTTAAGTAGATGACAGCTCTCGAGAGCTGTCATCTACTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016614.2-300s21c1
Sequence:CCGGCAACTGATTCCACCACTTCTACTCGAGTAGAAGTGGTGGAATCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016614.2-490s21c1
Sequence:CCGGCCCATATTATAGCTACCTAAACTCGAGTTTAGGTAGCTATAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016614.2-553s21c1
Sequence:CCGGAGGATATTTCACAGCTATAATCTCGAGATTATAGCTGTGAAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016614.2-892s21c1
Sequence:CCGGACCTAAACATTGCCAGTATACCTCGAGGTATACTGGCAATGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016614.x-791s1c1
Sequence:CCGGACAGTTATATTTGCAGGAGATCTCGAGATCTCCTGCAAATATAACTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016614.x-300s1c1
Sequence:CCGGCAACTGATTCCACCACTTCTACTCGAGTAGAAGTGGTGGAATCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016614.x-505s1c1
Sequence:CCGGCCTAAAGAAGAGATCAAGTAACTCGAGTTACTTGATCTCTTCTTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016614.x-1564s1c1
Sequence:CCGGGCAGTTAAGTAGATGACAGCTCTCGAGAGCTGTCATCTACTTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016614.x-992s1c1
Sequence:CCGGGCAGCAGAAGAGGGACACATTCTCGAGAATGTGTCCCTCTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks