EMAIL THIS PAGE TO A FRIEND

TDRD10

tudor domain containing 10

Gene ID:
cow(617793) tudor domain containing 10
sheep(101103865) tudor domain containing 10
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182499 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120661 MISSION® esiRNA esiRNA human TDRD10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098475 Rosetta Predictions human pricing
NM_182499 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318929 predicted 966
2 SASI_Hs02_00318930 predicted 2296
3 SASI_Hs02_00318931 predicted 1135
4 SASI_Hs02_00318932 predicted 2291
5 SASI_Hs02_00318933 predicted 871
6 SASI_Hs02_00318934 predicted 1269
7 SASI_Hs02_00318935 predicted 1257
8 SASI_Hs02_00318936 predicted 937
9 SASI_Hs02_00318937 predicted 2295
10 SASI_Hs02_00318938 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370547 predicted 963
2 SASI_Hs01_00125278 predicted 2100
3 SASI_Hs02_00370548 predicted 1130
4 SASI_Hs01_00125279 predicted 2093
5 SASI_Hs02_00370549 predicted 863
6 SASI_Hs02_00370550 predicted 1273
7 SASI_Hs01_00125284 predicted 1262
8 SASI_Hs02_00370551 predicted 929
9 SASI_Hs01_00125282 predicted 2102
10 SASI_Hs02_00370552 predicted 1035
11 SASI_Hs01_00125276 predicted 1864
12 SASI_Hs01_00125277 predicted 1279
13 SASI_Hs01_00125280 predicted 1866
14 SASI_Hs01_00125281 predicted 1210
15 SASI_Hs01_00125283 predicted 1704
16 SASI_Hs01_00125285 predicted 1800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182499
TDRD10 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 10
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182499.1-224s1c1
Sequence:CCGGCTTTGCAGTCCCGTTGGAAATCTCGAGATTTCCAACGGGACTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182499.3-1856s21c1
Sequence:CCGGTCGGCGTTGCACATCCTAAAGCTCGAGCTTTAGGATGTGCAACGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182499.3-954s21c1
Sequence:CCGGGCAATCTTCCACTGGATATTTCTCGAGAAATATCCAGTGGAAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182499.3-1669s21c1
Sequence:CCGGTGTGGTCATGTTCATTGATTTCTCGAGAAATCAATGAACATGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182499.3-1253s21c1
Sequence:CCGGATTATACAGCTCGCTCCTAAACTCGAGTTTAGGAGCGAGCTGTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182499.3-2010s21c1
Sequence:CCGGGTGCCCAGGATTGATTCAATTCTCGAGAATTGAATCAATCCTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182499
TDRD10 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 10
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182499.1-224s1c1
Sequence:CCGGCTTTGCAGTCCCGTTGGAAATCTCGAGATTTCCAACGGGACTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182499.3-1856s21c1
Sequence:CCGGTCGGCGTTGCACATCCTAAAGCTCGAGCTTTAGGATGTGCAACGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182499.3-954s21c1
Sequence:CCGGGCAATCTTCCACTGGATATTTCTCGAGAAATATCCAGTGGAAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182499.3-1669s21c1
Sequence:CCGGTGTGGTCATGTTCATTGATTTCTCGAGAAATCAATGAACATGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182499.3-1253s21c1
Sequence:CCGGATTATACAGCTCGCTCCTAAACTCGAGTTTAGGAGCGAGCTGTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182499.3-2010s21c1
Sequence:CCGGGTGCCCAGGATTGATTCAATTCTCGAGAATTGAATCAATCCTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182499
TDRD10 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 10
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182499.1-224s1c1
Sequence:CCGGCTTTGCAGTCCCGTTGGAAATCTCGAGATTTCCAACGGGACTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182499.3-1856s21c1
Sequence:CCGGTCGGCGTTGCACATCCTAAAGCTCGAGCTTTAGGATGTGCAACGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182499.3-954s21c1
Sequence:CCGGGCAATCTTCCACTGGATATTTCTCGAGAAATATCCAGTGGAAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182499.3-1669s21c1
Sequence:CCGGTGTGGTCATGTTCATTGATTTCTCGAGAAATCAATGAACATGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182499.3-1253s21c1
Sequence:CCGGATTATACAGCTCGCTCCTAAACTCGAGTTTAGGAGCGAGCTGTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182499.3-2010s21c1
Sequence:CCGGGTGCCCAGGATTGATTCAATTCTCGAGAATTGAATCAATCCTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks