EMAIL THIS PAGE TO A FRIEND

TDRD12

tudor domain containing 12

Synonyms: ECAT8
UniProtKB ID: Q587J7
Gene ID:
Mouse(71981) tudor domain containing 12
Rat(689639) tudor domain containing 12
chicken(768954) tudor domain containing 12
dog(612696) tudor domain containing 12
domestic cat(101083893) tudor domain containing 12
cow(615138) tudor domain containing 12
sheep(101117011) tudor domain containing 12
naked mole-rat(101719661) tudor domain containing 12
domestic guinea pig(100725637) tudor domain containing 12
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028034 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028034 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028034 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001110822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001110822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001110822 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001110822 Rosetta Predictions human pricing
XM_117117 Rosetta Predictions human pricing
XM_001071461 Rosetta Predictions rat pricing
NM_028034 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325055 predicted 1361
2 SASI_Hs02_00325056 predicted 627
3 SASI_Hs02_00325057 predicted 728
4 SASI_Hs02_00325058 predicted 815
5 SASI_Hs02_00325059 predicted 592
6 SASI_Hs02_00325060 predicted 754
7 SASI_Hs02_00325061 predicted 704
8 SASI_Hs02_00325062 predicted 1068
9 SASI_Hs02_00325063 predicted 901
10 SASI_Hs02_00325064 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_117117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257833 predicted 1565
2 SASI_Hs01_00257834 predicted 1467
3 SASI_Hs01_00257835 predicted 1505
4 SASI_Hs01_00257836 predicted 1619
5 SASI_Hs01_00257837 predicted 1678
6 SASI_Hs01_00257838 predicted 1574
7 SASI_Hs01_00257839 predicted 1672
8 SASI_Hs01_00257840 predicted 1437
9 SASI_Hs01_00257841 predicted 1485
10 SASI_Hs01_00257842 predicted 1607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335235 predicted 368
2 SASI_Rn02_00335236 predicted 1474
3 SASI_Rn02_00335237 predicted 1541
4 SASI_Rn02_00335238 predicted 1173
5 SASI_Rn02_00335239 predicted 1966
6 SASI_Rn02_00335240 predicted 1821
7 SASI_Rn02_00335241 predicted 1100
8 SASI_Rn02_00335242 predicted 975
9 SASI_Rn02_00335243 predicted 995
10 SASI_Rn02_00335244 predicted 1859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105612 predicted 469
2 SASI_Mm01_00105613 predicted 1366
3 SASI_Mm01_00105614 predicted 432
4 SASI_Mm01_00105615 predicted 749
5 SASI_Mm01_00105616 predicted 1066
6 SASI_Mm01_00105617 predicted 976
7 SASI_Mm01_00105618 predicted 374
8 SASI_Mm01_00105619 predicted 1253
9 SASI_Mm01_00105620 predicted 1205
10 SASI_Mm02_00333185 predicted 952
11 SASI_Mm01_00105621 predicted 408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028034
TDRD12 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028034.2-342s21c1
Sequence:CCGGCATGTGTCAGGACGTAGAAATCTCGAGATTTCTACGTCCTGACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028034.2-477s21c1
Sequence:CCGGAGAGTGTTTCCTGGTCGATTTCTCGAGAAATCGACCAGGAAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028034.2-757s21c1
Sequence:CCGGGTTTACCTTTATGCAACAATACTCGAGTATTGTTGCATAAAGGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028034.2-757s1c1
Sequence:CCGGGTTTACCTTTATGCAACAATACTCGAGTATTGTTGCATAAAGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028034.2-242s21c1
Sequence:CCGGCAGGTTGCTTCTGGGTAATTACTCGAGTAATTACCCAGAAGCAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028034.2-1433s21c1
Sequence:CCGGGACATGCCAGCCCTTTCCAACCTCGAGGTTGGAAAGGGCTGGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028034.1-291s1c1
Sequence:CCGGGACGTAGAAATGAAACCATTACTCGAGTAATGGTTTCATTTCTACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028034.1-1006s1c1
Sequence:CCGGCGGAGAAGTGTACTGAATCTTCTCGAGAAGATTCAGTACACTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028034.1-1151s1c1
Sequence:CCGGCGAGAAGAACGGCTGTGTAAACTCGAGTTTACACAGCCGTTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028034
TDRD12 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028034.2-342s21c1
Sequence:CCGGCATGTGTCAGGACGTAGAAATCTCGAGATTTCTACGTCCTGACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028034.2-477s21c1
Sequence:CCGGAGAGTGTTTCCTGGTCGATTTCTCGAGAAATCGACCAGGAAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028034.2-757s21c1
Sequence:CCGGGTTTACCTTTATGCAACAATACTCGAGTATTGTTGCATAAAGGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028034.2-757s1c1
Sequence:CCGGGTTTACCTTTATGCAACAATACTCGAGTATTGTTGCATAAAGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028034.2-242s21c1
Sequence:CCGGCAGGTTGCTTCTGGGTAATTACTCGAGTAATTACCCAGAAGCAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028034.2-1433s21c1
Sequence:CCGGGACATGCCAGCCCTTTCCAACCTCGAGGTTGGAAAGGGCTGGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028034.1-291s1c1
Sequence:CCGGGACGTAGAAATGAAACCATTACTCGAGTAATGGTTTCATTTCTACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028034.1-1006s1c1
Sequence:CCGGCGGAGAAGTGTACTGAATCTTCTCGAGAAGATTCAGTACACTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028034.1-1151s1c1
Sequence:CCGGCGAGAAGAACGGCTGTGTAAACTCGAGTTTACACAGCCGTTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028034
TDRD12 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028034.2-342s21c1
Sequence:CCGGCATGTGTCAGGACGTAGAAATCTCGAGATTTCTACGTCCTGACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028034.2-477s21c1
Sequence:CCGGAGAGTGTTTCCTGGTCGATTTCTCGAGAAATCGACCAGGAAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028034.2-757s21c1
Sequence:CCGGGTTTACCTTTATGCAACAATACTCGAGTATTGTTGCATAAAGGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028034.2-757s1c1
Sequence:CCGGGTTTACCTTTATGCAACAATACTCGAGTATTGTTGCATAAAGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028034.2-242s21c1
Sequence:CCGGCAGGTTGCTTCTGGGTAATTACTCGAGTAATTACCCAGAAGCAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028034.2-1433s21c1
Sequence:CCGGGACATGCCAGCCCTTTCCAACCTCGAGGTTGGAAAGGGCTGGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028034.1-291s1c1
Sequence:CCGGGACGTAGAAATGAAACCATTACTCGAGTAATGGTTTCATTTCTACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028034.1-1006s1c1
Sequence:CCGGCGGAGAAGTGTACTGAATCTTCTCGAGAAGATTCAGTACACTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028034.1-1151s1c1
Sequence:CCGGCGAGAAGAACGGCTGTGTAAACTCGAGTTTACACAGCCGTTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001110822
TDRD12 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-336s21c1
Sequence:GTACCGGAGGTTGCTTCTGGGTTATTATCTCGAGATAATAACCCAGAAGCAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-761s21c1
Sequence:GTACCGGATGCAGCTATTCAGTACTTTCCTCGAGGAAAGTACTGAATAGCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-804s21c1
Sequence:CCGGCCAGGTGGAAGCCAGATTATGCTCGAGCATAATCTGGCTTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-627s21c1
Sequence:CCGGAGTTGTAGTAGAATCGTTTATCTCGAGATAAACGATTCTACTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-377s21c1
Sequence:CCGGTAGATCATGATGTCGATTATCCTCGAGGATAATCGACATCATGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001110822
TDRD12 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-336s21c1
Sequence:GTACCGGAGGTTGCTTCTGGGTTATTATCTCGAGATAATAACCCAGAAGCAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-761s21c1
Sequence:GTACCGGATGCAGCTATTCAGTACTTTCCTCGAGGAAAGTACTGAATAGCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-804s21c1
Sequence:CCGGCCAGGTGGAAGCCAGATTATGCTCGAGCATAATCTGGCTTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-627s21c1
Sequence:CCGGAGTTGTAGTAGAATCGTTTATCTCGAGATAAACGATTCTACTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-377s21c1
Sequence:CCGGTAGATCATGATGTCGATTATCCTCGAGGATAATCGACATCATGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001110822
TDRD12 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-336s21c1
Sequence:GTACCGGAGGTTGCTTCTGGGTTATTATCTCGAGATAATAACCCAGAAGCAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-761s21c1
Sequence:GTACCGGATGCAGCTATTCAGTACTTTCCTCGAGGAAAGTACTGAATAGCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-804s21c1
Sequence:CCGGCCAGGTGGAAGCCAGATTATGCTCGAGCATAATCTGGCTTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-627s21c1
Sequence:CCGGAGTTGTAGTAGAATCGTTTATCTCGAGATAAACGATTCTACTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110822.1-377s21c1
Sequence:CCGGTAGATCATGATGTCGATTATCCTCGAGGATAATCGACATCATGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks