EMAIL THIS PAGE TO A FRIEND

TDRD1

tudor domain containing 1

Synonyms: CT41.1
Gene ID:
Human(56165) Summary: This gene is similar to a mouse gene that encodes a tudor domain protein. Alternatively spliced transcript variants have been described but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
Mouse(83561) tudor domain containing 1
Rat(292129) tudor domain containing 1
Zebrafish(553522) tudor domain containing 1
chicken(423906) tudor domain containing 1
dog(477826) tudor domain containing 1
Horse(100068184) tudor domain containing 1
cow(100849958) tudor domain containing 1
sheep(101118576) tudor domain containing 1
domestic guinea pig(100714321) tudor domain containing 1
naked mole-rat(101712546) tudor domain containing 1
Domestic Rabbit(100346562) tudor domain containing 1
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198795 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198795 Rosetta Predictions human pricing
NM_001106202 Rosetta Predictions rat pricing
NM_001002238 Rosetta Predictions mouse pricing
NM_001002240 Rosetta Predictions mouse pricing
NM_001002241 Rosetta Predictions mouse pricing
NM_031387 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372324 predicted 2348
2 SASI_Hs01_00162747 predicted 1871
3 SASI_Hs01_00162749 predicted 1029
4 SASI_Hs01_00162750 predicted 2191
5 SASI_Hs01_00162751 predicted 2761
6 SASI_Hs01_00162752 predicted 1374
7 SASI_Hs01_00162753 predicted 2615
8 SASI_Hs01_00162755 predicted 586
9 SASI_Hs02_00372325 predicted 576
10 SASI_Hs02_00372326 predicted 1339
11 SASI_Hs01_00162746 predicted 3432
12 SASI_Hs01_00162748 predicted 1991
13 SASI_Hs01_00162754 predicted 1783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216638 predicted 865
2 SASI_Rn02_00216639 predicted 2409
3 SASI_Rn02_00216640 predicted 3261
4 SASI_Rn02_00216641 predicted 3186
5 SASI_Rn02_00216642 predicted 1995
6 SASI_Rn02_00216643 predicted 2318
7 SASI_Rn02_00216644 predicted 3197
8 SASI_Rn02_00216645 predicted 3448
9 SASI_Rn02_00216646 predicted 3098
10 SASI_Rn02_00216647 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069296 predicted 1865
2 SASI_Mm01_00069298 predicted 1841
3 SASI_Mm01_00069299 predicted 2131
4 SASI_Mm01_00069300 predicted 1474
5 SASI_Mm01_00069301 predicted 3099
6 SASI_Mm01_00069302 predicted 1254
7 SASI_Mm01_00069303 predicted 3065
8 SASI_Mm01_00069304 predicted 2053
9 SASI_Mm01_00069305 predicted 1402
10 SASI_Mm02_00286277 predicted 3366
11 SASI_Mm01_00069297 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107198 predicted 1841
2 SASI_Mm01_00107200 predicted 1809
3 SASI_Mm02_00286280 predicted 826
4 SASI_Mm02_00286281 predicted 2941
5 SASI_Mm02_00286282 predicted 2421
6 SASI_Mm02_00286283 predicted 2831
7 SASI_Mm01_00107202 predicted 1445
8 SASI_Mm01_00107204 predicted 1228
9 SASI_Mm01_00107205 predicted 3032
10 SASI_Mm01_00107206 predicted 2023
11 SASI_Mm01_00107199 predicted 1506
12 SASI_Mm01_00107201 predicted 2108
13 SASI_Mm01_00107203 predicted 3087
14 SASI_Mm01_00107207 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047135 predicted 2138
2 SASI_Mm01_00047137 predicted 2109
3 SASI_Mm01_00047138 predicted 2401
4 SASI_Mm01_00047139 predicted 1753
5 SASI_Mm01_00047140 predicted 3381
6 SASI_Mm01_00047141 predicted 1531
7 SASI_Mm01_00047142 predicted 3330
8 SASI_Mm01_00047143 predicted 2327
9 SASI_Mm01_00047144 predicted 1670
10 SASI_Mm02_00286284 predicted 3634
11 SASI_Mm01_00047136 predicted 1810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151242 predicted 1199
2 SASI_Mm01_00151244 predicted 1170
3 SASI_Mm01_00151245 predicted 1456
4 SASI_Mm01_00151246 predicted 801
5 SASI_Mm01_00151247 predicted 2434
6 SASI_Mm01_00151248 predicted 588
7 SASI_Mm01_00151249 predicted 2391
8 SASI_Mm01_00151250 predicted 1376
9 SASI_Mm01_00151251 predicted 725
10 SASI_Mm02_00337133 predicted 2688
11 SASI_Mm01_00151243 predicted 859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031387
TDRD1 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031387.3-2625s21c1
Sequence:CCGGGACCAACTCCAGGCGATATTACTCGAGTAATATCGCCTGGAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031387.2-1739s1c1
Sequence:CCGGCTCTAGTCAAGGAGATCTTACCTCGAGGTAAGATCTCCTTGACTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031387.2-510s1c1
Sequence:CCGGGTTTCCTCCTTCTGCCATAAACTCGAGTTTATGGCAGAAGGAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031387.3-2572s21c1
Sequence:CCGGGGAATGTTAAAGTCCACTTTGCTCGAGCAAAGTGGACTTTAACATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031387.3-1611s21c1
Sequence:CCGGGTGACAGTTGAGAGCAAGATTCTCGAGAATCTTGCTCTCAACTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031387.2-355s1c1
Sequence:CCGGGTTGCCAAATACACAGTTGATCTCGAGATCAACTGTGTATTTGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031387.2-1045s1c1
Sequence:CCGGGCTCAGTTCTCAGAGGATGATCTCGAGATCATCCTCTGAGAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031387.2-2111s1c1
Sequence:CCGGGCAGACCTGCTAATCAACATACTCGAGTATGTTGATTAGCAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031387.2-2218s1c1
Sequence:CCGGGCAAATGTACTAGAGATCATACTCGAGTATGATCTCTAGTACATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031387.2-1621s1c1
Sequence:CCGGGATGACTTGAATCAGTCCTTACTCGAGTAAGGACTGATTCAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031387
TDRD1 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031387.3-2625s21c1
Sequence:CCGGGACCAACTCCAGGCGATATTACTCGAGTAATATCGCCTGGAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031387.2-1739s1c1
Sequence:CCGGCTCTAGTCAAGGAGATCTTACCTCGAGGTAAGATCTCCTTGACTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031387.2-510s1c1
Sequence:CCGGGTTTCCTCCTTCTGCCATAAACTCGAGTTTATGGCAGAAGGAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031387.3-2572s21c1
Sequence:CCGGGGAATGTTAAAGTCCACTTTGCTCGAGCAAAGTGGACTTTAACATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031387.3-1611s21c1
Sequence:CCGGGTGACAGTTGAGAGCAAGATTCTCGAGAATCTTGCTCTCAACTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031387.2-355s1c1
Sequence:CCGGGTTGCCAAATACACAGTTGATCTCGAGATCAACTGTGTATTTGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031387.2-1045s1c1
Sequence:CCGGGCTCAGTTCTCAGAGGATGATCTCGAGATCATCCTCTGAGAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031387.2-2111s1c1
Sequence:CCGGGCAGACCTGCTAATCAACATACTCGAGTATGTTGATTAGCAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031387.2-2218s1c1
Sequence:CCGGGCAAATGTACTAGAGATCATACTCGAGTATGATCTCTAGTACATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031387.2-1621s1c1
Sequence:CCGGGATGACTTGAATCAGTCCTTACTCGAGTAAGGACTGATTCAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031387
TDRD1 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031387.3-2625s21c1
Sequence:CCGGGACCAACTCCAGGCGATATTACTCGAGTAATATCGCCTGGAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031387.2-1739s1c1
Sequence:CCGGCTCTAGTCAAGGAGATCTTACCTCGAGGTAAGATCTCCTTGACTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031387.2-510s1c1
Sequence:CCGGGTTTCCTCCTTCTGCCATAAACTCGAGTTTATGGCAGAAGGAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031387.3-2572s21c1
Sequence:CCGGGGAATGTTAAAGTCCACTTTGCTCGAGCAAAGTGGACTTTAACATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031387.3-1611s21c1
Sequence:CCGGGTGACAGTTGAGAGCAAGATTCTCGAGAATCTTGCTCTCAACTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031387.2-355s1c1
Sequence:CCGGGTTGCCAAATACACAGTTGATCTCGAGATCAACTGTGTATTTGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031387.2-1045s1c1
Sequence:CCGGGCTCAGTTCTCAGAGGATGATCTCGAGATCATCCTCTGAGAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031387.2-2111s1c1
Sequence:CCGGGCAGACCTGCTAATCAACATACTCGAGTATGTTGATTAGCAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031387.2-2218s1c1
Sequence:CCGGGCAAATGTACTAGAGATCATACTCGAGTATGATCTCTAGTACATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031387.2-1621s1c1
Sequence:CCGGGATGACTTGAATCAGTCCTTACTCGAGTAAGGACTGATTCAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198795
TDRD1 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198795.1-986s21c1
Sequence:CCGGACTTCTACGTGCAGTTATATTCTCGAGAATATAACTGCACGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198795.1-3961s21c1
Sequence:CCGGTAGGGACTTTCTGCTATATATCTCGAGATATATAGCAGAAAGTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198795.1-1950s21c1
Sequence:CCGGATTGCCAATGCAAGCTATAAACTCGAGTTTATAGCTTGCATTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198795.1-3315s21c1
Sequence:CCGGATGTTCACTTGAAGGATTAATCTCGAGATTAATCCTTCAAGTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198795.1-1915s21c1
Sequence:CCGGATGAGACTTTGTCCCATAATCCTCGAGGATTATGGGACAAAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-300s1c1
Sequence:CCGGCCACCCTAATTTCAGGCTGAACTCGAGTTCAGCCTGAAATTAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-2128s1c1
Sequence:CCGGCCTCATGTCAGTGTTAGCAAACTCGAGTTTGCTAACACTGACATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-1981s1c1
Sequence:CCGGGCAGGAGTAAAGCCATCATTACTCGAGTAATGATGGCTTTACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-2851s1c1
Sequence:CCGGCCACATAAAGACTTACCAAATCTCGAGATTTGGTAAGTCTTTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198795.1-4241s1c1
Sequence:CCGGCCACATAATGTCCTTTGCTTTCTCGAGAAAGCAAAGGACATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-2783s1c1
Sequence:CCGGCCACTTGTTATCCCAGAATAACTCGAGTTATTCTGGGATAACAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198795.1-4252s1c1
Sequence:CCGGCCTTTGCTTTCATGTTTGTTACTCGAGTAACAAACATGAAAGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198795.1-3949s1c1
Sequence:CCGGGCAAGGAATACATAGGGACTTCTCGAGAAGTCCCTATGTATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198795
TDRD1 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198795.1-986s21c1
Sequence:CCGGACTTCTACGTGCAGTTATATTCTCGAGAATATAACTGCACGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198795.1-3961s21c1
Sequence:CCGGTAGGGACTTTCTGCTATATATCTCGAGATATATAGCAGAAAGTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198795.1-1950s21c1
Sequence:CCGGATTGCCAATGCAAGCTATAAACTCGAGTTTATAGCTTGCATTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198795.1-3315s21c1
Sequence:CCGGATGTTCACTTGAAGGATTAATCTCGAGATTAATCCTTCAAGTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198795.1-1915s21c1
Sequence:CCGGATGAGACTTTGTCCCATAATCCTCGAGGATTATGGGACAAAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-300s1c1
Sequence:CCGGCCACCCTAATTTCAGGCTGAACTCGAGTTCAGCCTGAAATTAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-2128s1c1
Sequence:CCGGCCTCATGTCAGTGTTAGCAAACTCGAGTTTGCTAACACTGACATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-1981s1c1
Sequence:CCGGGCAGGAGTAAAGCCATCATTACTCGAGTAATGATGGCTTTACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-2851s1c1
Sequence:CCGGCCACATAAAGACTTACCAAATCTCGAGATTTGGTAAGTCTTTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198795.1-4241s1c1
Sequence:CCGGCCACATAATGTCCTTTGCTTTCTCGAGAAAGCAAAGGACATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-2783s1c1
Sequence:CCGGCCACTTGTTATCCCAGAATAACTCGAGTTATTCTGGGATAACAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198795.1-4252s1c1
Sequence:CCGGCCTTTGCTTTCATGTTTGTTACTCGAGTAACAAACATGAAAGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198795.1-3949s1c1
Sequence:CCGGGCAAGGAATACATAGGGACTTCTCGAGAAGTCCCTATGTATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198795
TDRD1 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198795.1-986s21c1
Sequence:CCGGACTTCTACGTGCAGTTATATTCTCGAGAATATAACTGCACGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198795.1-3961s21c1
Sequence:CCGGTAGGGACTTTCTGCTATATATCTCGAGATATATAGCAGAAAGTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198795.1-1950s21c1
Sequence:CCGGATTGCCAATGCAAGCTATAAACTCGAGTTTATAGCTTGCATTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198795.1-3315s21c1
Sequence:CCGGATGTTCACTTGAAGGATTAATCTCGAGATTAATCCTTCAAGTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198795.1-1915s21c1
Sequence:CCGGATGAGACTTTGTCCCATAATCCTCGAGGATTATGGGACAAAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-300s1c1
Sequence:CCGGCCACCCTAATTTCAGGCTGAACTCGAGTTCAGCCTGAAATTAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-2128s1c1
Sequence:CCGGCCTCATGTCAGTGTTAGCAAACTCGAGTTTGCTAACACTGACATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-1981s1c1
Sequence:CCGGGCAGGAGTAAAGCCATCATTACTCGAGTAATGATGGCTTTACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-2851s1c1
Sequence:CCGGCCACATAAAGACTTACCAAATCTCGAGATTTGGTAAGTCTTTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198795.1-4241s1c1
Sequence:CCGGCCACATAATGTCCTTTGCTTTCTCGAGAAAGCAAAGGACATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198795.1-2783s1c1
Sequence:CCGGCCACTTGTTATCCCAGAATAACTCGAGTTATTCTGGGATAACAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198795.1-4252s1c1
Sequence:CCGGCCTTTGCTTTCATGTTTGTTACTCGAGTAACAAACATGAAAGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198795.1-3949s1c1
Sequence:CCGGGCAAGGAATACATAGGGACTTCTCGAGAAGTCCCTATGTATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks