EMAIL THIS PAGE TO A FRIEND

TDRD3

tudor domain containing 3

UniProtKB ID: Q9H7E2, B2MWP9, Q53XA6, Q6P992
Gene ID:
Mouse(219249) tudor domain containing 3
Rat(306066) tudor domain containing 3
Zebrafish(402828) tudor domain containing 3
dog(491346) tudor domain containing 3
Horse(100063561) tudor domain containing 3
domestic cat(101096281) tudor domain containing 3
chicken(418823) tudor domain containing 3
domestic guinea pig(100726695) tudor domain containing 3
naked mole-rat(101713672) tudor domain containing 3
cow(537918) tudor domain containing 3
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411761 Anti-TDRD3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030794 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030794 Rosetta Predictions human pricing
NM_001012043 Rosetta Predictions rat pricing
XM_573827 Rosetta Predictions rat pricing
NM_172605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223613 predicted 1885
2 SASI_Hs01_00223614 predicted 1710
3 SASI_Hs01_00223615 predicted 891
4 SASI_Hs01_00223616 predicted 864
5 SASI_Hs01_00223617 predicted 1696
6 SASI_Hs02_00358348 predicted 490
7 SASI_Hs01_00223618 predicted 328
8 SASI_Hs01_00223619 predicted 540
9 SASI_Hs01_00223620 predicted 736
10 SASI_Hs01_00223621 predicted 1396
11 SASI_Hs01_00223622 predicted 1852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113601 predicted 454
2 SASI_Rn01_00113602 predicted 1579
3 SASI_Rn01_00113603 predicted 715
4 SASI_Rn02_00200142 predicted 1862
5 SASI_Rn01_00113605 predicted 2273
6 SASI_Rn01_00113606 predicted 1547
7 SASI_Rn01_00113607 predicted 923
8 SASI_Rn02_00200143 predicted 467
9 SASI_Rn01_00113608 predicted 625
10 SASI_Rn02_00200144 predicted 556
11 SASI_Rn01_00113604 predicted 897
12 SASI_Rn01_00113609 predicted 1473
13 SASI_Rn01_00113610 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139902 predicted 1405
2 SASI_Rn01_00139903 predicted 543
3 SASI_Rn01_00139904 predicted 714
4 SASI_Rn01_00139905 predicted 1533
5 SASI_Rn01_00139906 predicted 1369
6 SASI_Rn01_00139907 predicted 753
7 SASI_Rn01_00139908 predicted 450
8 SASI_Rn01_00139909 predicted 390
9 SASI_Rn01_00139910 predicted 1296
10 SASI_Rn01_00139911 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049172 predicted 2151
2 SASI_Mm01_00049173 predicted 956
3 SASI_Mm01_00049174 predicted 1004
4 SASI_Mm01_00049175 predicted 1349
5 SASI_Mm01_00049177 predicted 2067
6 SASI_Mm02_00344304 predicted 1541
7 SASI_Mm01_00049178 predicted 425
8 SASI_Mm01_00049179 predicted 438
9 SASI_Mm01_00049180 predicted 1212
10 SASI_Mm01_00049181 predicted 598
11 SASI_Mm01_00049176 predicted 1458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030794
TDRD3 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030794.1-2282s1c1
Sequence:CCGGCCTTCCACTTTCTCTTCAGAACTCGAGTTCTGAAGAGAAAGTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030794.1-941s1c1
Sequence:CCGGCGTACTTCTTACAAGCAATAACTCGAGTTATTGCTTGTAAGAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030794.1-574s1c1
Sequence:CCGGGCAGAGAACTTGATCGAAGAACTCGAGTTCTTCGATCAAGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030794.1-1303s1c1
Sequence:CCGGGCAGTGGATTACCTAGAAATACTCGAGTATTTCTAGGTAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030794.2-2836s21c1
Sequence:CCGGAGTAGCTGTGGTGGATATTATCTCGAGATAATATCCACCACAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030794.1-2005s1c2
Sequence:CCGGCGGGTATGACAGCAGTTGTTACTCGAGTAACAACTGCTGTCATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030794.2-2301s21c1
Sequence:CCGGAGACGAATAGGACCTATTAAGCTCGAGCTTAATAGGTCCTATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030794.2-2384s21c1
Sequence:CCGGACGAAGATCTGGGCCAATTAACTCGAGTTAATTGGCCCAGATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030794
TDRD3 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030794.1-2282s1c1
Sequence:CCGGCCTTCCACTTTCTCTTCAGAACTCGAGTTCTGAAGAGAAAGTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030794.1-941s1c1
Sequence:CCGGCGTACTTCTTACAAGCAATAACTCGAGTTATTGCTTGTAAGAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030794.1-574s1c1
Sequence:CCGGGCAGAGAACTTGATCGAAGAACTCGAGTTCTTCGATCAAGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030794.1-1303s1c1
Sequence:CCGGGCAGTGGATTACCTAGAAATACTCGAGTATTTCTAGGTAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030794.2-2836s21c1
Sequence:CCGGAGTAGCTGTGGTGGATATTATCTCGAGATAATATCCACCACAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030794.1-2005s1c2
Sequence:CCGGCGGGTATGACAGCAGTTGTTACTCGAGTAACAACTGCTGTCATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030794.2-2301s21c1
Sequence:CCGGAGACGAATAGGACCTATTAAGCTCGAGCTTAATAGGTCCTATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030794.2-2384s21c1
Sequence:CCGGACGAAGATCTGGGCCAATTAACTCGAGTTAATTGGCCCAGATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030794
TDRD3 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030794.1-2282s1c1
Sequence:CCGGCCTTCCACTTTCTCTTCAGAACTCGAGTTCTGAAGAGAAAGTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030794.1-941s1c1
Sequence:CCGGCGTACTTCTTACAAGCAATAACTCGAGTTATTGCTTGTAAGAAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030794.1-574s1c1
Sequence:CCGGGCAGAGAACTTGATCGAAGAACTCGAGTTCTTCGATCAAGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030794.1-1303s1c1
Sequence:CCGGGCAGTGGATTACCTAGAAATACTCGAGTATTTCTAGGTAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030794.2-2836s21c1
Sequence:CCGGAGTAGCTGTGGTGGATATTATCTCGAGATAATATCCACCACAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030794.1-2005s1c2
Sequence:CCGGCGGGTATGACAGCAGTTGTTACTCGAGTAACAACTGCTGTCATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030794.2-2301s21c1
Sequence:CCGGAGACGAATAGGACCTATTAAGCTCGAGCTTAATAGGTCCTATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030794.2-2384s21c1
Sequence:CCGGACGAAGATCTGGGCCAATTAACTCGAGTTAATTGGCCCAGATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172605
TDRD3 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172605.2-2441s1c1
Sequence:CCGGGAGACTCAATATGCTGGATATCTCGAGATATCCAGCATATTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172605.2-956s1c1
Sequence:CCGGGCAAGAACGAAGGTGTCTATACTCGAGTATAGACACCTTCGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172605.2-874s1c1
Sequence:CCGGGCCAGAAGTAATCTCAATATTCTCGAGAATATTGAGATTACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172605.2-1777s1c1
Sequence:CCGGCCACGGACAATGAATAGTGAACTCGAGTTCACTATTCATTGTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172605.2-446s1c1
Sequence:CCGGCGGCAGTAGAATTCAGTTATACTCGAGTATAACTGAATTCTACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-1629s21c1
Sequence:CCGGCAAGTGTGACAGGCCATATTCCTCGAGGAATATGGCCTGTCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172605.3-2503s21c1
Sequence:CCGGTGGAAGCCCACTGATAGATTTCTCGAGAAATCTATCAGTGGGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-2052s21c1
Sequence:CCGGAGCTGTGCCCTACGATGATAACTCGAGTTATCATCGTAGGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-1306s21c1
Sequence:CCGGTCAGCACCAAGCACGTTATTTCTCGAGAAATAACGTGCTTGGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-679s21c1
Sequence:CCGGGGTGAAGTGGAACACCTAATTCTCGAGAATTAGGTGTTCCACTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-2273s21c1
Sequence:CCGGTCACGGACTACGGCAACTATGCTCGAGCATAGTTGCCGTAGTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172605
TDRD3 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172605.2-2441s1c1
Sequence:CCGGGAGACTCAATATGCTGGATATCTCGAGATATCCAGCATATTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172605.2-956s1c1
Sequence:CCGGGCAAGAACGAAGGTGTCTATACTCGAGTATAGACACCTTCGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172605.2-874s1c1
Sequence:CCGGGCCAGAAGTAATCTCAATATTCTCGAGAATATTGAGATTACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172605.2-1777s1c1
Sequence:CCGGCCACGGACAATGAATAGTGAACTCGAGTTCACTATTCATTGTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172605.2-446s1c1
Sequence:CCGGCGGCAGTAGAATTCAGTTATACTCGAGTATAACTGAATTCTACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-1629s21c1
Sequence:CCGGCAAGTGTGACAGGCCATATTCCTCGAGGAATATGGCCTGTCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172605.3-2503s21c1
Sequence:CCGGTGGAAGCCCACTGATAGATTTCTCGAGAAATCTATCAGTGGGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-2052s21c1
Sequence:CCGGAGCTGTGCCCTACGATGATAACTCGAGTTATCATCGTAGGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-1306s21c1
Sequence:CCGGTCAGCACCAAGCACGTTATTTCTCGAGAAATAACGTGCTTGGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-679s21c1
Sequence:CCGGGGTGAAGTGGAACACCTAATTCTCGAGAATTAGGTGTTCCACTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-2273s21c1
Sequence:CCGGTCACGGACTACGGCAACTATGCTCGAGCATAGTTGCCGTAGTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172605
TDRD3 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172605.2-2441s1c1
Sequence:CCGGGAGACTCAATATGCTGGATATCTCGAGATATCCAGCATATTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172605.2-956s1c1
Sequence:CCGGGCAAGAACGAAGGTGTCTATACTCGAGTATAGACACCTTCGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172605.2-874s1c1
Sequence:CCGGGCCAGAAGTAATCTCAATATTCTCGAGAATATTGAGATTACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172605.2-1777s1c1
Sequence:CCGGCCACGGACAATGAATAGTGAACTCGAGTTCACTATTCATTGTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172605.2-446s1c1
Sequence:CCGGCGGCAGTAGAATTCAGTTATACTCGAGTATAACTGAATTCTACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-1629s21c1
Sequence:CCGGCAAGTGTGACAGGCCATATTCCTCGAGGAATATGGCCTGTCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172605.3-2503s21c1
Sequence:CCGGTGGAAGCCCACTGATAGATTTCTCGAGAAATCTATCAGTGGGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-2052s21c1
Sequence:CCGGAGCTGTGCCCTACGATGATAACTCGAGTTATCATCGTAGGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-1306s21c1
Sequence:CCGGTCAGCACCAAGCACGTTATTTCTCGAGAAATAACGTGCTTGGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-679s21c1
Sequence:CCGGGGTGAAGTGGAACACCTAATTCTCGAGAATTAGGTGTTCCACTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172605.3-2273s21c1
Sequence:CCGGTCACGGACTACGGCAACTATGCTCGAGCATAGTTGCCGTAGTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks