EMAIL THIS PAGE TO A FRIEND

TDRD5

tudor domain containing 5

Synonyms: RP11-427G13.1 TUDOR3
UniProtKB ID: Q8NAT2, A1L4G5, B7ZLV0, Q5EBN4, Q5VTV0, Q6ZSK2
Gene ID:
Mouse(214575) tudor domain containing 5
Rat(289129) tudor domain containing 5
cow(537634) tudor domain containing 5
sheep(101119150) tudor domain containing 5
naked mole-rat(101704115) tudor domain containing 5
Domestic Rabbit(100338496) tudor domain containing 5
domestic guinea pig(100715908) tudor domain containing 5
Zebrafish(557999) tudor domain containing 5
dog(480050) tudor domain containing 5
Horse(100050707) tudor domain containing 5
domestic cat(101085172) tudor domain containing 5
chicken(424421) tudor domain containing 5
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173533 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001134741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001134741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001134741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145691 MISSION® esiRNA esiRNA human TDRD5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173533 Rosetta Predictions human pricing
NM_001134739 Rosetta Predictions rat pricing
NM_001134740 Rosetta Predictions rat pricing
XM_129603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217133 predicted 1762
2 SASI_Hs01_00217134 predicted 752
3 SASI_Hs01_00217135 predicted 2992
4 SASI_Hs01_00217137 predicted 3078
5 SASI_Hs01_00217138 predicted 1764
6 SASI_Hs01_00217139 predicted 2162
7 SASI_Hs01_00217140 predicted 1127
8 SASI_Hs02_00368326 predicted 2739
9 SASI_Hs01_00217142 predicted 404
10 SASI_Hs02_00368327 predicted 361
11 SASI_Hs01_00217136 predicted 2787
12 SASI_Hs01_00217141 predicted 1851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258274 predicted 2179
2 SASI_Rn02_00258275 predicted 203
3 SASI_Rn02_00258276 predicted 1032
4 SASI_Rn02_00258277 predicted 1305
5 SASI_Rn02_00258278 predicted 785
6 SASI_Rn02_00258279 predicted 1278
7 SASI_Rn02_00258280 predicted 1858
8 SASI_Rn02_00258281 predicted 2495
9 SASI_Rn02_00258282 predicted 1131
10 SASI_Rn02_00258283 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258284 predicted 2179
2 SASI_Rn02_00258285 predicted 205
3 SASI_Rn02_00258286 predicted 1035
4 SASI_Rn02_00258287 predicted 1312
5 SASI_Rn02_00258288 predicted 778
6 SASI_Rn02_00258289 predicted 1276
7 SASI_Rn02_00258290 predicted 1852
8 SASI_Rn02_00258291 predicted 2499
9 SASI_Rn02_00258292 predicted 1130
10 SASI_Rn02_00258293 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424311 predicted 2083
2 SASI_Mm01_00205232 predicted 1279
3 SASI_Mm01_00205235 predicted 1494
4 SASI_Mm01_00205237 predicted 1458
5 SASI_Mm01_00205238 predicted 1358
6 SASI_Mm02_00424312 predicted 2773
7 SASI_Mm02_00424313 predicted 3034
8 SASI_Mm01_00205239 predicted 3257
9 SASI_Mm01_00205240 predicted 1531
10 SASI_Mm01_00205241 predicted 3088
11 SASI_Mm01_00205233 predicted 1019
12 SASI_Mm01_00205234 predicted 344
13 SASI_Mm01_00205236 predicted 1188
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173533
TDRD5 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173533.2-565s21c1
Sequence:CCGGTAAGGGAAGACCTAGTATTTACTCGAGTAAATACTAGGTCTTCCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173533.2-1687s21c1
Sequence:CCGGTATCATCTCTCCTAGTCAATTCTCGAGAATTGACTAGGAGAGATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173533.2-2663s21c1
Sequence:CCGGACGAAAGTAGAAGTCCATAAGCTCGAGCTTATGGACTTCTACTTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-1445s1c1
Sequence:CCGGGCTGCTGTCAAAGAGACTGTACTCGAGTACAGTCTCTTTGACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-1919s1c1
Sequence:CCGGGAAGTGTTCTACCCAGACTTTCTCGAGAAAGTCTGGGTAGAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-2995s1c1
Sequence:CCGGCCGTGCTATTACATTGTACAACTCGAGTTGTACAATGTAATAGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173533.2-3333s1c1
Sequence:CCGGGCTTTATTATGCTAACAGTCTCTCGAGAGACTGTTAGCATAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159561    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173533.2-3350s1c1
Sequence:CCGGGTCTACTTTGATGTGTAAGTACTCGAGTACTTACACATCAAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-2169s1c1
Sequence:CCGGCCTCAAACGAAGATGTCTATTCTCGAGAATAGACATCTTCGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-1207s1c1
Sequence:CCGGGCTTGGAGAGTATGAGGTAATCTCGAGATTACCTCATACTCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173533
TDRD5 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173533.2-565s21c1
Sequence:CCGGTAAGGGAAGACCTAGTATTTACTCGAGTAAATACTAGGTCTTCCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173533.2-1687s21c1
Sequence:CCGGTATCATCTCTCCTAGTCAATTCTCGAGAATTGACTAGGAGAGATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173533.2-2663s21c1
Sequence:CCGGACGAAAGTAGAAGTCCATAAGCTCGAGCTTATGGACTTCTACTTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-1445s1c1
Sequence:CCGGGCTGCTGTCAAAGAGACTGTACTCGAGTACAGTCTCTTTGACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-1919s1c1
Sequence:CCGGGAAGTGTTCTACCCAGACTTTCTCGAGAAAGTCTGGGTAGAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-2995s1c1
Sequence:CCGGCCGTGCTATTACATTGTACAACTCGAGTTGTACAATGTAATAGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173533.2-3333s1c1
Sequence:CCGGGCTTTATTATGCTAACAGTCTCTCGAGAGACTGTTAGCATAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159561    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173533.2-3350s1c1
Sequence:CCGGGTCTACTTTGATGTGTAAGTACTCGAGTACTTACACATCAAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-2169s1c1
Sequence:CCGGCCTCAAACGAAGATGTCTATTCTCGAGAATAGACATCTTCGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-1207s1c1
Sequence:CCGGGCTTGGAGAGTATGAGGTAATCTCGAGATTACCTCATACTCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173533
TDRD5 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173533.2-565s21c1
Sequence:CCGGTAAGGGAAGACCTAGTATTTACTCGAGTAAATACTAGGTCTTCCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173533.2-1687s21c1
Sequence:CCGGTATCATCTCTCCTAGTCAATTCTCGAGAATTGACTAGGAGAGATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173533.2-2663s21c1
Sequence:CCGGACGAAAGTAGAAGTCCATAAGCTCGAGCTTATGGACTTCTACTTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-1445s1c1
Sequence:CCGGGCTGCTGTCAAAGAGACTGTACTCGAGTACAGTCTCTTTGACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-1919s1c1
Sequence:CCGGGAAGTGTTCTACCCAGACTTTCTCGAGAAAGTCTGGGTAGAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-2995s1c1
Sequence:CCGGCCGTGCTATTACATTGTACAACTCGAGTTGTACAATGTAATAGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173533.2-3333s1c1
Sequence:CCGGGCTTTATTATGCTAACAGTCTCTCGAGAGACTGTTAGCATAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159561    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173533.2-3350s1c1
Sequence:CCGGGTCTACTTTGATGTGTAAGTACTCGAGTACTTACACATCAAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-2169s1c1
Sequence:CCGGCCTCAAACGAAGATGTCTATTCTCGAGAATAGACATCTTCGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173533.2-1207s1c1
Sequence:CCGGGCTTGGAGAGTATGAGGTAATCTCGAGATTACCTCATACTCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134741
TDRD5 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134741.1-796s21c1
Sequence:CCGGGCGAAGACACCCACGTTTAATCTCGAGATTAAACGTGGGTGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134741.1-3226s21c1
Sequence:CCGGCTGACTACTTTGATGTGTAAGCTCGAGCTTACACATCAAAGTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134741.1-1607s21c1
Sequence:CCGGTGGTCTCTGACCGGTACATTACTCGAGTAATGTACCGGTCAGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134741.1-2149s21c1
Sequence:CCGGCCTGCTCAGCAGCACTATTTACTCGAGTAAATAGTGCTGCTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134741.1-1743s21c1
Sequence:CCGGCTACCCAGATTTCGGAAATATCTCGAGATATTTCCGAAATCTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134741
TDRD5 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134741.1-796s21c1
Sequence:CCGGGCGAAGACACCCACGTTTAATCTCGAGATTAAACGTGGGTGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134741.1-3226s21c1
Sequence:CCGGCTGACTACTTTGATGTGTAAGCTCGAGCTTACACATCAAAGTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134741.1-1607s21c1
Sequence:CCGGTGGTCTCTGACCGGTACATTACTCGAGTAATGTACCGGTCAGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134741.1-2149s21c1
Sequence:CCGGCCTGCTCAGCAGCACTATTTACTCGAGTAAATAGTGCTGCTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134741.1-1743s21c1
Sequence:CCGGCTACCCAGATTTCGGAAATATCTCGAGATATTTCCGAAATCTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134741
TDRD5 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134741.1-796s21c1
Sequence:CCGGGCGAAGACACCCACGTTTAATCTCGAGATTAAACGTGGGTGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134741.1-3226s21c1
Sequence:CCGGCTGACTACTTTGATGTGTAAGCTCGAGCTTACACATCAAAGTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134741.1-1607s21c1
Sequence:CCGGTGGTCTCTGACCGGTACATTACTCGAGTAATGTACCGGTCAGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134741.1-2149s21c1
Sequence:CCGGCCTGCTCAGCAGCACTATTTACTCGAGTAAATAGTGCTGCTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134741.1-1743s21c1
Sequence:CCGGCTACCCAGATTTCGGAAATATCTCGAGATATTTCCGAAATCTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks