EMAIL THIS PAGE TO A FRIEND

TDRD6

tudor domain containing 6

Synonyms: CT41.2 NY-CO-45 SPATA36 TDR2 bA446F17.4
UniProtKB ID: O60522, B3KWU2, F5H5M3, Q5HYB1, Q5VTS4, Q6ZMX5
Gene ID:
Mouse(210510) tudor domain containing 6
Rat(316254) tudor domain containing 6
Zebrafish(565665) tudor domain containing 6
Horse(100068352) tudor domain containing 6
domestic cat(101090106) tudor domain containing 6
dog(474925) tudor domain containing 6
chicken(428669) tudor domain containing 6
Zebrafish(799498) Tudor domain-containing protein 6
domestic guinea pig(100733051) tudor domain containing 6
Domestic Rabbit(100339909) tudor domain containing 6
naked mole-rat(101701709) tudor domain containing 6
cow(512705) tudor domain containing 6
sheep(101116263) tudor domain containing 6
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010870 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012101 MISSION® esiRNA esiRNA targeting human TDRD6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010870 Rosetta Predictions human pricing
XM_001068575 Rosetta Predictions rat pricing
XM_236991 Rosetta Predictions rat pricing
NM_198418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305825 predicted 4896
2 SASI_Hs01_00203074 predicted 1426
3 SASI_Hs01_00203075 predicted 2701
4 SASI_Hs01_00203076 predicted 4126
5 SASI_Hs01_00203077 predicted 5475
6 SASI_Hs01_00203078 predicted 4027
7 SASI_Hs01_00203079 predicted 6019
8 SASI_Hs01_00203080 predicted 1271
9 SASI_Hs02_00305826 predicted 6279
10 SASI_Hs02_00305827 predicted 3101
11 SASI_Hs01_00203081 predicted 2395
12 SASI_Hs01_00203082 predicted 2957
13 SASI_Hs01_00203083 predicted 5928
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325030 predicted 1333
2 SASI_Rn02_00325031 predicted 5722
3 SASI_Rn02_00325032 predicted 5595
4 SASI_Rn02_00325033 predicted 6246
5 SASI_Rn02_00325034 predicted 3841
6 SASI_Rn02_00325035 predicted 5480
7 SASI_Rn02_00325036 predicted 4761
8 SASI_Rn02_00325037 predicted 2269
9 SASI_Rn02_00325038 predicted 1463
10 SASI_Rn02_00325039 predicted 6035
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390600 predicted 1333
2 SASI_Rn02_00390601 predicted 3845
3 SASI_Rn02_00390602 predicted 2007
4 SASI_Rn02_00390603 predicted 4547
5 SASI_Rn02_00390604 predicted 4762
6 SASI_Rn02_00390605 predicted 2271
7 SASI_Rn02_00390606 predicted 1464
8 SASI_Rn02_00390607 predicted 3635
9 SASI_Rn02_00390608 predicted 4676
10 SASI_Rn02_00390609 predicted 3128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051818 predicted 3777
2 SASI_Mm01_00051820 predicted 5484
3 SASI_Mm01_00051821 predicted 6548
4 SASI_Mm02_00350978 predicted 5596
5 SASI_Mm01_00051822 predicted 6050
6 SASI_Mm02_00350979 predicted 1066
7 SASI_Mm01_00051823 predicted 5246
8 SASI_Mm01_00051824 predicted 4840
9 SASI_Mm01_00051825 predicted 4642
10 SASI_Mm02_00350980 predicted 4881
11 SASI_Mm01_00051817 predicted 5702
12 SASI_Mm01_00051819 predicted 5569
13 SASI_Mm01_00051826 predicted 3830
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010870
TDRD6 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-2375s1c1
Sequence:CCGGCCAGGAACATACAAGGACTTACTCGAGTAAGTCCTTGTATGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-5701s1c1
Sequence:CCGGGCTGAGAAACAGCCAGAACTACTCGAGTAGTTCTGGCTGTTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-2067s1c1
Sequence:CCGGCCACTTTACTACGGAGAGTAACTCGAGTTACTCTCCGTAGTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-6031s1c1
Sequence:CCGGCCAGATCATATCTCAGCTCAACTCGAGTTGAGCTGAGATATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-4424s1c1
Sequence:CCGGGCAGGTATGCTCTCAGTGAAACTCGAGTTTCACTGAGAGCATACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010870.1-1796s21c1
Sequence:CCGGAGTGCACCCTGGCTGATATTTCTCGAGAAATATCAGCCAGGGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010870.1-1767s21c1
Sequence:CCGGGTTTAGGCAGCTACCAATATTCTCGAGAATATTGGTAGCTGCCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010870.1-4690s21c1
Sequence:CCGGTGTATCCCATGTCCTTATATTCTCGAGAATATAAGGACATGGGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010870.1-3397s21c1
Sequence:CCGGCCAGATGGAACACTGATTATACTCGAGTATAATCAGTGTTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010870
TDRD6 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-2375s1c1
Sequence:CCGGCCAGGAACATACAAGGACTTACTCGAGTAAGTCCTTGTATGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-5701s1c1
Sequence:CCGGGCTGAGAAACAGCCAGAACTACTCGAGTAGTTCTGGCTGTTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-2067s1c1
Sequence:CCGGCCACTTTACTACGGAGAGTAACTCGAGTTACTCTCCGTAGTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-6031s1c1
Sequence:CCGGCCAGATCATATCTCAGCTCAACTCGAGTTGAGCTGAGATATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-4424s1c1
Sequence:CCGGGCAGGTATGCTCTCAGTGAAACTCGAGTTTCACTGAGAGCATACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010870.1-1796s21c1
Sequence:CCGGAGTGCACCCTGGCTGATATTTCTCGAGAAATATCAGCCAGGGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010870.1-1767s21c1
Sequence:CCGGGTTTAGGCAGCTACCAATATTCTCGAGAATATTGGTAGCTGCCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010870.1-4690s21c1
Sequence:CCGGTGTATCCCATGTCCTTATATTCTCGAGAATATAAGGACATGGGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010870.1-3397s21c1
Sequence:CCGGCCAGATGGAACACTGATTATACTCGAGTATAATCAGTGTTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010870
TDRD6 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-2375s1c1
Sequence:CCGGCCAGGAACATACAAGGACTTACTCGAGTAAGTCCTTGTATGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-5701s1c1
Sequence:CCGGGCTGAGAAACAGCCAGAACTACTCGAGTAGTTCTGGCTGTTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-2067s1c1
Sequence:CCGGCCACTTTACTACGGAGAGTAACTCGAGTTACTCTCCGTAGTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-6031s1c1
Sequence:CCGGCCAGATCATATCTCAGCTCAACTCGAGTTGAGCTGAGATATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010870.1-4424s1c1
Sequence:CCGGGCAGGTATGCTCTCAGTGAAACTCGAGTTTCACTGAGAGCATACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010870.1-1796s21c1
Sequence:CCGGAGTGCACCCTGGCTGATATTTCTCGAGAAATATCAGCCAGGGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010870.1-1767s21c1
Sequence:CCGGGTTTAGGCAGCTACCAATATTCTCGAGAATATTGGTAGCTGCCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010870.1-4690s21c1
Sequence:CCGGTGTATCCCATGTCCTTATATTCTCGAGAATATAAGGACATGGGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010870.1-3397s21c1
Sequence:CCGGCCAGATGGAACACTGATTATACTCGAGTATAATCAGTGTTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198418
TDRD6 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 6
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198418.1-4564s1c1
Sequence:CCGGGAAGATATGATTAGCAGGTTTCTCGAGAAACCTGCTAATCATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192388    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198418.1-6556s1c1
Sequence:CCGGCCAATCAGAAGCCGTCTTTAACTCGAGTTAAAGACGGCTTCTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198418.1-5590s21c1
Sequence:CCGGACGGGATTTAACCCGATATTGCTCGAGCAATATCGGGTTAAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198418.1-3163s21c1
Sequence:CCGGTATTGCCAGCTCGCGAGAAATCTCGAGATTTCTCGCGAGCTGGCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198418.1-3551s21c1
Sequence:CCGGACCCAGATGGGAGACTAATTACTCGAGTAATTAGTCTCCCATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198418.1-1220s21c1
Sequence:CCGGGCTATCTGCTGCCGGAGTATTCTCGAGAATACTCCGGCAGCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198418
TDRD6 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 6
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198418.1-4564s1c1
Sequence:CCGGGAAGATATGATTAGCAGGTTTCTCGAGAAACCTGCTAATCATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192388    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198418.1-6556s1c1
Sequence:CCGGCCAATCAGAAGCCGTCTTTAACTCGAGTTAAAGACGGCTTCTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198418.1-5590s21c1
Sequence:CCGGACGGGATTTAACCCGATATTGCTCGAGCAATATCGGGTTAAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198418.1-3163s21c1
Sequence:CCGGTATTGCCAGCTCGCGAGAAATCTCGAGATTTCTCGCGAGCTGGCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198418.1-3551s21c1
Sequence:CCGGACCCAGATGGGAGACTAATTACTCGAGTAATTAGTCTCCCATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198418.1-1220s21c1
Sequence:CCGGGCTATCTGCTGCCGGAGTATTCTCGAGAATACTCCGGCAGCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198418
TDRD6 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 6
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198418.1-4564s1c1
Sequence:CCGGGAAGATATGATTAGCAGGTTTCTCGAGAAACCTGCTAATCATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192388    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198418.1-6556s1c1
Sequence:CCGGCCAATCAGAAGCCGTCTTTAACTCGAGTTAAAGACGGCTTCTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198418.1-5590s21c1
Sequence:CCGGACGGGATTTAACCCGATATTGCTCGAGCAATATCGGGTTAAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198418.1-3163s21c1
Sequence:CCGGTATTGCCAGCTCGCGAGAAATCTCGAGATTTCTCGCGAGCTGGCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198418.1-3551s21c1
Sequence:CCGGACCCAGATGGGAGACTAATTACTCGAGTAATTAGTCTCCCATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198418.1-1220s21c1
Sequence:CCGGGCTATCTGCTGCCGGAGTATTCTCGAGAATACTCCGGCAGCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks