EMAIL THIS PAGE TO A FRIEND

TDRD7

tudor domain containing 7

Synonyms: CATC4 CTRCT36 PCTAIRE2BP RP11-508D10.1 TRAP
Gene ID:
Human(23424) Summary: This gene encodes a component of cytoplasmic RNA granules which are involved in determining the fate of mRNAs. Mutation in this gene has been associated with pediatric cataracts. Mutation of the similar gene in mice has been associated with cataracts, glaucoma and a block in spermatogenesis. [provided by RefSeq, May 2011]
Mouse(100121) tudor domain containing 7
Rat(85425) tudor domain containing 7
cow(506702) tudor domain containing 7
sheep(101104963) tudor domain containing 7
naked mole-rat(101698451) tudor domain containing 7
Domestic Rabbit(100338110) tudor domain containing 7
domestic guinea pig(100715890) tudor domain containing 7
Zebrafish(406379) tudor domain containing 7
domestic cat(101082100) tudor domain containing 7
dog(474770) tudor domain containing 7
chicken(430492) tudor domain containing 7
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014290 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014290 Rosetta Predictions human pricing
NM_138871 Rosetta Predictions rat pricing
NM_146142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206274 predicted 3211
2 SASI_Hs01_00206275 predicted 1553
3 SASI_Hs01_00206276 predicted 2555
4 SASI_Hs01_00206277 predicted 811
5 SASI_Hs01_00206278 predicted 628
6 SASI_Hs01_00206280 predicted 1616
7 SASI_Hs01_00206281 predicted 2060
8 SASI_Hs01_00206282 predicted 662
9 SASI_Hs01_00206283 predicted 777
10 SASI_Hs02_00345379 predicted 3193
11 SASI_Hs01_00206279 predicted 2900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268281 predicted 1620
2 SASI_Rn01_00084497 predicted 1477
3 SASI_Rn01_00084498 predicted 3266
4 SASI_Rn01_00084499 predicted 1413
5 SASI_Rn01_00084500 predicted 3626
6 SASI_Rn01_00084502 predicted 3641
7 SASI_Rn01_00084503 predicted 1761
8 SASI_Rn01_00084504 predicted 1047
9 SASI_Rn02_00268282 predicted 2481
10 SASI_Rn02_00268283 predicted 2412
11 SASI_Rn01_00084501 predicted 336
12 SASI_Rn01_00084505 predicted 698
13 SASI_Rn01_00084506 predicted 2826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088013 predicted 3279
2 SASI_Mm02_00341830 predicted 3141
3 SASI_Mm01_00088014 predicted 1959
4 SASI_Mm01_00088015 predicted 1130
5 SASI_Mm01_00088017 predicted 1066
6 SASI_Mm01_00088018 predicted 469
7 SASI_Mm01_00088019 predicted 722
8 SASI_Mm01_00088020 predicted 1410
9 SASI_Mm01_00088021 predicted 431
10 SASI_Mm02_00341831 predicted 2804
11 SASI_Mm01_00088012 predicted 1278
12 SASI_Mm01_00088016 predicted 1020
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146142
TDRD7 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146142.1-2203s21c1
Sequence:CCGGGCAATTCGACATCCGTGAAAGCTCGAGCTTTCACGGATGTCGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146142.1-1948s21c1
Sequence:CCGGATGTCAAAGTGACCAACATTTCTCGAGAAATGTTGGTCACTTTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146142.1-2971s21c1
Sequence:CCGGAGCATGAGCTCGTCAACATAACTCGAGTTATGTTGACGAGCTCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146142.1-282s21c1
Sequence:CCGGGCTCGTCAGAGGACCTCTAAACTCGAGTTTAGAGGTCCTCTGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146142.1-3287s1c1
Sequence:CCGGGCTTGAGATGTTGACCGCTAACTCGAGTTAGCGGTCAACATCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146142.1-2380s1c1
Sequence:CCGGCGGACTGTAGTATTAAGGTTACTCGAGTAACCTTAATACTACAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146142.1-609s1c1
Sequence:CCGGCCTACGGAAGTCAATGATAATCTCGAGATTATCATTGACTTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146142.1-2142s1c1
Sequence:CCGGCGAGTGGAGATCACTAATGTTCTCGAGAACATTAGTGATCTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146142.1-65s1c1
Sequence:CCGGGCAGTCTCATAAGAACGGGATCTCGAGATCCCGTTCTTATGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146142
TDRD7 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146142.1-2203s21c1
Sequence:CCGGGCAATTCGACATCCGTGAAAGCTCGAGCTTTCACGGATGTCGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146142.1-1948s21c1
Sequence:CCGGATGTCAAAGTGACCAACATTTCTCGAGAAATGTTGGTCACTTTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146142.1-2971s21c1
Sequence:CCGGAGCATGAGCTCGTCAACATAACTCGAGTTATGTTGACGAGCTCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146142.1-282s21c1
Sequence:CCGGGCTCGTCAGAGGACCTCTAAACTCGAGTTTAGAGGTCCTCTGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146142.1-3287s1c1
Sequence:CCGGGCTTGAGATGTTGACCGCTAACTCGAGTTAGCGGTCAACATCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146142.1-2380s1c1
Sequence:CCGGCGGACTGTAGTATTAAGGTTACTCGAGTAACCTTAATACTACAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146142.1-609s1c1
Sequence:CCGGCCTACGGAAGTCAATGATAATCTCGAGATTATCATTGACTTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146142.1-2142s1c1
Sequence:CCGGCGAGTGGAGATCACTAATGTTCTCGAGAACATTAGTGATCTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146142.1-65s1c1
Sequence:CCGGGCAGTCTCATAAGAACGGGATCTCGAGATCCCGTTCTTATGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146142
TDRD7 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146142.1-2203s21c1
Sequence:CCGGGCAATTCGACATCCGTGAAAGCTCGAGCTTTCACGGATGTCGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146142.1-1948s21c1
Sequence:CCGGATGTCAAAGTGACCAACATTTCTCGAGAAATGTTGGTCACTTTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146142.1-2971s21c1
Sequence:CCGGAGCATGAGCTCGTCAACATAACTCGAGTTATGTTGACGAGCTCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146142.1-282s21c1
Sequence:CCGGGCTCGTCAGAGGACCTCTAAACTCGAGTTTAGAGGTCCTCTGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146142.1-3287s1c1
Sequence:CCGGGCTTGAGATGTTGACCGCTAACTCGAGTTAGCGGTCAACATCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146142.1-2380s1c1
Sequence:CCGGCGGACTGTAGTATTAAGGTTACTCGAGTAACCTTAATACTACAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146142.1-609s1c1
Sequence:CCGGCCTACGGAAGTCAATGATAATCTCGAGATTATCATTGACTTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146142.1-2142s1c1
Sequence:CCGGCGAGTGGAGATCACTAATGTTCTCGAGAACATTAGTGATCTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146142.1-65s1c1
Sequence:CCGGGCAGTCTCATAAGAACGGGATCTCGAGATCCCGTTCTTATGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014290
VALIDATED
TDRD7 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014290.2-3202s21c1
Sequence:CCGGGATTATGGCAAACACGAATTACTCGAGTAATTCGTGTTTGCCATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014290.2-2120s21c1
Sequence:CCGGCCACCTGCTTGAAGGCTATATCTCGAGATATAGCCTTCAAGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014290.2-1545s21c1
Sequence:CCGGCATTGCTGAAAGTGCTAATACCTCGAGGTATTAGCACTTTCAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014290.2-1231s21c1
Sequence:CCGGGTTATGGCAGGAGACTTTAAACTCGAGTTTAAAGTCTCCTGCCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014290.2-636s21c1
Sequence:CCGGACCTAATCCAGCACCGTTAAGCTCGAGCTTAACGGTGCTGGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014290.1-1642s1c1
Sequence:CCGGGCAACACAAATGAAGTGGTTACTCGAGTAACCACTTCATTTGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014290.1-1422s1c1
Sequence:CCGGGCCATTCTCTATGCTAAACTTCTCGAGAAGTTTAGCATAGAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014290.1-2713s1c1
Sequence:CCGGGCAGTATTAATCGCCAGATTACTCGAGTAATCTGGCGATTAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014290.1-2382s1c1
Sequence:CCGGCGAGTAGAGATCACAAATGTTCTCGAGAACATTTGTGATCTCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014290.1-3537s1c1
Sequence:CCGGCCTTGACAACTAATTCAGATTCTCGAGAATCTGAATTAGTTGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014290.1-3528s1c1
Sequence:CCGGCCTCTGAAACCTTGACAACTACTCGAGTAGTTGTCAAGGTTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014290
VALIDATED
TDRD7 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014290.2-3202s21c1
Sequence:CCGGGATTATGGCAAACACGAATTACTCGAGTAATTCGTGTTTGCCATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014290.2-2120s21c1
Sequence:CCGGCCACCTGCTTGAAGGCTATATCTCGAGATATAGCCTTCAAGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014290.2-1545s21c1
Sequence:CCGGCATTGCTGAAAGTGCTAATACCTCGAGGTATTAGCACTTTCAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014290.2-1231s21c1
Sequence:CCGGGTTATGGCAGGAGACTTTAAACTCGAGTTTAAAGTCTCCTGCCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014290.2-636s21c1
Sequence:CCGGACCTAATCCAGCACCGTTAAGCTCGAGCTTAACGGTGCTGGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014290.1-1642s1c1
Sequence:CCGGGCAACACAAATGAAGTGGTTACTCGAGTAACCACTTCATTTGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014290.1-1422s1c1
Sequence:CCGGGCCATTCTCTATGCTAAACTTCTCGAGAAGTTTAGCATAGAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014290.1-2713s1c1
Sequence:CCGGGCAGTATTAATCGCCAGATTACTCGAGTAATCTGGCGATTAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014290.1-2382s1c1
Sequence:CCGGCGAGTAGAGATCACAAATGTTCTCGAGAACATTTGTGATCTCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014290.1-3537s1c1
Sequence:CCGGCCTTGACAACTAATTCAGATTCTCGAGAATCTGAATTAGTTGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014290.1-3528s1c1
Sequence:CCGGCCTCTGAAACCTTGACAACTACTCGAGTAGTTGTCAAGGTTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014290
VALIDATED
TDRD7 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014290.2-3202s21c1
Sequence:CCGGGATTATGGCAAACACGAATTACTCGAGTAATTCGTGTTTGCCATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014290.2-2120s21c1
Sequence:CCGGCCACCTGCTTGAAGGCTATATCTCGAGATATAGCCTTCAAGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014290.2-1545s21c1
Sequence:CCGGCATTGCTGAAAGTGCTAATACCTCGAGGTATTAGCACTTTCAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014290.2-1231s21c1
Sequence:CCGGGTTATGGCAGGAGACTTTAAACTCGAGTTTAAAGTCTCCTGCCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014290.2-636s21c1
Sequence:CCGGACCTAATCCAGCACCGTTAAGCTCGAGCTTAACGGTGCTGGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014290.1-1642s1c1
Sequence:CCGGGCAACACAAATGAAGTGGTTACTCGAGTAACCACTTCATTTGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014290.1-1422s1c1
Sequence:CCGGGCCATTCTCTATGCTAAACTTCTCGAGAAGTTTAGCATAGAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014290.1-2713s1c1
Sequence:CCGGGCAGTATTAATCGCCAGATTACTCGAGTAATCTGGCGATTAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014290.1-2382s1c1
Sequence:CCGGCGAGTAGAGATCACAAATGTTCTCGAGAACATTTGTGATCTCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014290.1-3537s1c1
Sequence:CCGGCCTTGACAACTAATTCAGATTCTCGAGAATCTGAATTAGTTGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014290.1-3528s1c1
Sequence:CCGGCCTCTGAAACCTTGACAACTACTCGAGTAGTTGTCAAGGTTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks