EMAIL THIS PAGE TO A FRIEND

TDRD9

tudor domain containing 9

Synonyms: C14orf75 HIG-1 NET54
Gene ID:
Mouse(74691) tudor domain containing 9
Rat(299343) tudor domain containing 9
Zebrafish(553222) tudor domain containing 9
Horse(100060700) tudor domain containing 9
chicken(423488) tudor domain containing 9
domestic cat(101100061) tudor domain containing 9
dog(100687431) tudor domain containing 9
domestic guinea pig(100713429) tudor domain containing 9
naked mole-rat(101699035) tudor domain containing 9
cow(525070) tudor domain containing 9
sheep(101103188) tudor domain containing 9
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038120 Anti-TDRD9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106389 Anti-TDRD9 antibody produced in rabbit affinity isolated antibody canine, human, guinea pig, horse, mouse, rat, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153046 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058971 MISSION® esiRNA esiRNA human TDRD9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153046 Rosetta Predictions human pricing
XM_001072421 Rosetta Predictions rat pricing
XM_001078318 Rosetta Predictions rat pricing
XM_001475772 Rosetta Predictions mouse pricing
XM_127120 Rosetta Predictions mouse pricing
XM_988185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187226 predicted 1839
2 SASI_Hs01_00187228 predicted 2665
3 SASI_Hs01_00187229 predicted 2236
4 SASI_Hs01_00187230 predicted 2981
5 SASI_Hs01_00187231 predicted 2709
6 SASI_Hs02_00366999 predicted 942
7 SASI_Hs02_00367000 predicted 984
8 SASI_Hs02_00367001 predicted 3648
9 SASI_Hs01_00187233 predicted 1603
10 SASI_Hs02_00367002 predicted 3761
11 SASI_Hs01_00187227 predicted 1682
12 SASI_Hs01_00187232 predicted 1521
13 SASI_Hs01_00187234 predicted 260
14 SASI_Hs01_00187235 predicted 2642
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339099 predicted 2000
2 SASI_Rn02_00339100 predicted 1627
3 SASI_Rn02_00339101 predicted 2655
4 SASI_Rn02_00339102 predicted 3506
5 SASI_Rn02_00339103 predicted 2209
6 SASI_Rn02_00339104 predicted 3254
7 SASI_Rn02_00339105 predicted 234
8 SASI_Rn02_00339106 predicted 1295
9 SASI_Rn02_00339107 predicted 670
10 SASI_Rn02_00339108 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360370 predicted 272
2 SASI_Rn02_00360371 predicted 267
3 SASI_Rn02_00360372 predicted 278
4 SASI_Rn02_00360373 predicted 223
5 SASI_Rn02_00360374 predicted 218
6 SASI_Rn02_00360375 predicted 269
7 SASI_Rn02_00360376 predicted 288
8 SASI_Rn02_00360377 predicted 271
9 SASI_Rn02_00360378 predicted 276
10 SASI_Rn02_00360379 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00384852 predicted 340
2 SASI_Mm02_00384853 predicted 970
3 SASI_Mm02_00384854 predicted 3344
4 SASI_Mm02_00384855 predicted 3248
5 SASI_Mm02_00384856 predicted 269
6 SASI_Mm02_00384857 predicted 340
7 SASI_Mm02_00384858 predicted 426
8 SASI_Mm02_00384859 predicted 3245
9 SASI_Mm02_00384860 predicted 926
10 SASI_Mm02_00384861 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127120 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214068 predicted 2016
2 SASI_Mm01_00214069 predicted 2421
3 SASI_Mm01_00214070 predicted 198
4 SASI_Mm01_00214071 predicted 971
5 SASI_Mm01_00214072 predicted 1714
6 SASI_Mm01_00214073 predicted 343
7 SASI_Mm01_00214074 predicted 1032
8 SASI_Mm01_00214075 predicted 2454
9 SASI_Mm01_00214076 predicted 1470
10 SASI_Mm01_00214077 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00449590 predicted 3156
2 SASI_Mm02_00449591 predicted 2514
3 SASI_Mm02_00449592 predicted 1060
4 SASI_Mm02_00449593 predicted 1803
5 SASI_Mm02_00449594 predicted 3082
6 SASI_Mm02_00449595 predicted 433
7 SASI_Mm02_00449596 predicted 1120
8 SASI_Mm02_00449597 predicted 2544
9 SASI_Mm02_00449598 predicted 1558
10 SASI_Mm02_00449599 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153046
TDRD9 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153046.1-215s1c1
Sequence:CCGGCCGGTGATAACTAAGGATATACTCGAGTATATCCTTAGTTATCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153046.1-1412s1c1
Sequence:CCGGGCAGGTGCTTTCTATCCAAATCTCGAGATTTGGATAGAAAGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153046.1-2171s1c1
Sequence:CCGGCCCTGTCAATTTCTTGAACTTCTCGAGAAGTTCAAGAAATTGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153046.1-1526s1c1
Sequence:CCGGCCCTATGGATTTCTTTACTATCTCGAGATAGTAAAGAAATCCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153046.2-3725s21c1
Sequence:CCGGTCGCACCGGTGATAGAGTTAACTCGAGTTAACTCTATCACCGGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153046.2-613s21c1
Sequence:CCGGATCGCCAGGTGGATCAGTAAACTCGAGTTTACTGATCCACCTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153046.2-3872s21c1
Sequence:CCGGAGGATGTCGTCGAGGTTAATACTCGAGTATTAACCTCGACGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153046.2-1719s21c1
Sequence:CCGGGCGCACCATCCTTCTACTAAACTCGAGTTTAGTAGAAGGATGGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153046
TDRD9 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153046.1-215s1c1
Sequence:CCGGCCGGTGATAACTAAGGATATACTCGAGTATATCCTTAGTTATCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153046.1-1412s1c1
Sequence:CCGGGCAGGTGCTTTCTATCCAAATCTCGAGATTTGGATAGAAAGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153046.1-2171s1c1
Sequence:CCGGCCCTGTCAATTTCTTGAACTTCTCGAGAAGTTCAAGAAATTGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153046.1-1526s1c1
Sequence:CCGGCCCTATGGATTTCTTTACTATCTCGAGATAGTAAAGAAATCCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153046.2-3725s21c1
Sequence:CCGGTCGCACCGGTGATAGAGTTAACTCGAGTTAACTCTATCACCGGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153046.2-613s21c1
Sequence:CCGGATCGCCAGGTGGATCAGTAAACTCGAGTTTACTGATCCACCTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153046.2-3872s21c1
Sequence:CCGGAGGATGTCGTCGAGGTTAATACTCGAGTATTAACCTCGACGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153046.2-1719s21c1
Sequence:CCGGGCGCACCATCCTTCTACTAAACTCGAGTTTAGTAGAAGGATGGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153046
TDRD9 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153046.1-215s1c1
Sequence:CCGGCCGGTGATAACTAAGGATATACTCGAGTATATCCTTAGTTATCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153046.1-1412s1c1
Sequence:CCGGGCAGGTGCTTTCTATCCAAATCTCGAGATTTGGATAGAAAGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153046.1-2171s1c1
Sequence:CCGGCCCTGTCAATTTCTTGAACTTCTCGAGAAGTTCAAGAAATTGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153046.1-1526s1c1
Sequence:CCGGCCCTATGGATTTCTTTACTATCTCGAGATAGTAAAGAAATCCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153046.2-3725s21c1
Sequence:CCGGTCGCACCGGTGATAGAGTTAACTCGAGTTAACTCTATCACCGGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153046.2-613s21c1
Sequence:CCGGATCGCCAGGTGGATCAGTAAACTCGAGTTTACTGATCCACCTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153046.2-3872s21c1
Sequence:CCGGAGGATGTCGTCGAGGTTAATACTCGAGTATTAACCTCGACGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153046.2-1719s21c1
Sequence:CCGGGCGCACCATCCTTCTACTAAACTCGAGTTTAGTAGAAGGATGGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029056
TDRD9 MISSION shRNA Bacterial Glycerol Stock
tudor domain containing 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029056.1-3902s21c1
Sequence:CCGGGGCCTTTGATGTGCGCTTAAACTCGAGTTTAAGCGCACATCAAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029056.1-418s21c1
Sequence:CCGGGGTCACCATTGGCTAAGTTAACTCGAGTTAACTTAGCCAATGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029056.1-483s21c1
Sequence:CCGGTTGCCTATAAATCGGTGTAAACTCGAGTTTACACCGATTTATAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029056.1-321s21c1
Sequence:CCGGAGCTCAGAAATGGAGTATATTCTCGAGAATATACTCCATTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029056.1-4441s21c1
Sequence:CCGGGTATGAGGGTAAATCTAAATACTCGAGTATTTAGATTTACCCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029056
TDRD9 MISSION shRNA shRNA Plasmid DNA
tudor domain containing 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029056.1-3902s21c1
Sequence:CCGGGGCCTTTGATGTGCGCTTAAACTCGAGTTTAAGCGCACATCAAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029056.1-418s21c1
Sequence:CCGGGGTCACCATTGGCTAAGTTAACTCGAGTTAACTTAGCCAATGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029056.1-483s21c1
Sequence:CCGGTTGCCTATAAATCGGTGTAAACTCGAGTTTACACCGATTTATAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029056.1-321s21c1
Sequence:CCGGAGCTCAGAAATGGAGTATATTCTCGAGAATATACTCCATTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029056.1-4441s21c1
Sequence:CCGGGTATGAGGGTAAATCTAAATACTCGAGTATTTAGATTTACCCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029056
TDRD9 MISSION shRNA Lentiviral Transduction Particles
tudor domain containing 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029056.1-3902s21c1
Sequence:CCGGGGCCTTTGATGTGCGCTTAAACTCGAGTTTAAGCGCACATCAAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029056.1-418s21c1
Sequence:CCGGGGTCACCATTGGCTAAGTTAACTCGAGTTAACTTAGCCAATGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029056.1-483s21c1
Sequence:CCGGTTGCCTATAAATCGGTGTAAACTCGAGTTTACACCGATTTATAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029056.1-321s21c1
Sequence:CCGGAGCTCAGAAATGGAGTATATTCTCGAGAATATACTCCATTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029056.1-4441s21c1
Sequence:CCGGGTATGAGGGTAAATCTAAATACTCGAGTATTTAGATTTACCCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks