EMAIL THIS PAGE TO A FRIEND

TDRKH

tudor and KH domain containing

Synonyms: TDRD2
UniProtKB ID: Q9Y2W6, D3DV24, Q5SZR3, Q5SZR5, Q8N582, Q9NYV5
Gene ID:
Mouse(72634) tudor and KH domain containing protein
Rat(310652) tudor and KH domain containing
Zebrafish(541541) tudor and KH domain containing
Horse(100055640) tudor and KH domain containing
domestic cat(101081402) tudor and KH domain containing
dog(609125) tudor and KH domain containing
chicken(425667) tudor and KH domain containing
cow(515706) tudor and KH domain containing
sheep(101119519) tudor and KH domain containing
naked mole-rat(101699479) tudor and KH domain containing
domestic guinea pig(100714350) tudor and KH domain containing
226 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006862 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083963 Rosetta Predictions human pricing
NM_001083964 Rosetta Predictions human pricing
NM_001083965 Rosetta Predictions human pricing
NM_006862 Rosetta Predictions human pricing
XM_001053329 Rosetta Predictions rat pricing
XM_227438 Rosetta Predictions rat pricing
NM_028307 Rosetta Predictions mouse pricing
XM_131021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317391 predicted 1393
2 SASI_Hs02_00317392 predicted 1550
3 SASI_Hs02_00317393 predicted 1588
4 SASI_Hs02_00317394 predicted 1564
5 SASI_Hs02_00317395 predicted 1108
6 SASI_Hs02_00317396 predicted 1587
7 SASI_Hs02_00317397 predicted 1074
8 SASI_Hs02_00317398 predicted 1016
9 SASI_Hs02_00317399 predicted 1299
10 SASI_Hs02_00317400 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317401 predicted 1276
2 SASI_Hs02_00317402 predicted 1441
3 SASI_Hs02_00317403 predicted 1480
4 SASI_Hs02_00317404 predicted 1455
5 SASI_Hs02_00317405 predicted 999
6 SASI_Hs02_00317406 predicted 1480
7 SASI_Hs02_00317407 predicted 908
8 SASI_Hs02_00317408 predicted 1182
9 SASI_Hs02_00317409 predicted 1105
10 SASI_Hs02_00317410 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317411 predicted 1410
2 SASI_Hs02_00317412 predicted 1575
3 SASI_Hs02_00317413 predicted 1614
4 SASI_Hs02_00317414 predicted 1586
5 SASI_Hs02_00317415 predicted 1131
6 SASI_Hs02_00317416 predicted 1613
7 SASI_Hs02_00317417 predicted 1104
8 SASI_Hs02_00317418 predicted 1043
9 SASI_Hs02_00317419 predicted 1323
10 SASI_Hs02_00317420 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117129 predicted 1417
2 SASI_Hs02_00342481 predicted 1575
3 SASI_Hs01_00117130 predicted 1614
4 SASI_Hs01_00117131 predicted 1582
5 SASI_Hs01_00117135 predicted 1132
6 SASI_Hs02_00342482 predicted 1614
7 SASI_Hs02_00342483 predicted 1098
8 SASI_Hs02_00342484 predicted 1035
9 SASI_Hs02_00342485 predicted 1321
10 SASI_Hs02_00342486 predicted 1236
11 SASI_Hs01_00117128 predicted 616
12 SASI_Hs01_00117132 predicted 672
13 SASI_Hs01_00117133 predicted 672
14 SASI_Hs01_00117134 predicted 1973
15 SASI_Hs01_00117136 predicted 1838
16 SASI_Hs01_00117137 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271967 predicted 1541
2 SASI_Rn02_00271968 predicted 1349
3 SASI_Rn02_00271969 predicted 1291
4 SASI_Rn02_00271970 predicted 617
5 SASI_Rn02_00271971 predicted 671
6 SASI_Rn02_00271972 predicted 1186
7 SASI_Rn02_00271973 predicted 1675
8 SASI_Rn02_00271974 predicted 542
9 SASI_Rn02_00271975 predicted 1216
10 SASI_Rn02_00271976 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227438 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384391 predicted 1546
2 SASI_Rn02_00384392 predicted 1508
3 SASI_Rn02_00384393 predicted 1511
4 SASI_Rn02_00384394 predicted 1508
5 SASI_Rn02_00384395 predicted 1554
6 SASI_Rn02_00384396 predicted 1677
7 SASI_Rn02_00384397 predicted 1429
8 SASI_Rn02_00384398 predicted 1530
9 SASI_Rn02_00384399 predicted 1430
10 SASI_Rn02_00384400 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333656 predicted 1254
2 SASI_Mm02_00333657 predicted 821
3 SASI_Mm02_00333658 predicted 1717
4 SASI_Mm02_00333659 predicted 1640
5 SASI_Mm02_00333660 predicted 624
6 SASI_Mm02_00333661 predicted 579
7 SASI_Mm02_00333662 predicted 198
8 SASI_Mm02_00333663 predicted 1150
9 SASI_Mm02_00333664 predicted 1174
10 SASI_Mm02_00333665 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250575 predicted 1264
2 SASI_Mm01_00250576 predicted 636
3 SASI_Mm01_00250577 predicted 577
4 SASI_Mm01_00250578 predicted 574
5 SASI_Mm01_00250579 predicted 1309
6 SASI_Mm01_00250580 predicted 689
7 SASI_Mm01_00250581 predicted 1546
8 SASI_Mm01_00250582 predicted 509
9 SASI_Mm01_00250583 predicted 1516
10 SASI_Mm01_00250584 predicted 1582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028307
TDRKH MISSION shRNA Bacterial Glycerol Stock
tudor and KH domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028307.1-283s21c1
Sequence:CCGGGTCGACAAGGAGCCAATATTACTCGAGTAATATTGGCTCCTTGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028307.1-170s21c1
Sequence:CCGGCATTCTGTATCGTCGATATAGCTCGAGCTATATCGACGATACAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028307.1-1735s21c1
Sequence:CCGGATAACCTTGAAGACGACTTATCTCGAGATAAGTCGTCTTCAAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028307.1-580s21c1
Sequence:CCGGTACTACTCTCACGACTTATAACTCGAGTTATAAGTCGTGAGAGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028307.1-2291s21c1
Sequence:CCGGCAGATTTCTGACTCGACTTATCTCGAGATAAGTCGAGTCAGAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028307
TDRKH MISSION shRNA shRNA Plasmid DNA
tudor and KH domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028307.1-283s21c1
Sequence:CCGGGTCGACAAGGAGCCAATATTACTCGAGTAATATTGGCTCCTTGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028307.1-170s21c1
Sequence:CCGGCATTCTGTATCGTCGATATAGCTCGAGCTATATCGACGATACAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028307.1-1735s21c1
Sequence:CCGGATAACCTTGAAGACGACTTATCTCGAGATAAGTCGTCTTCAAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028307.1-580s21c1
Sequence:CCGGTACTACTCTCACGACTTATAACTCGAGTTATAAGTCGTGAGAGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028307.1-2291s21c1
Sequence:CCGGCAGATTTCTGACTCGACTTATCTCGAGATAAGTCGAGTCAGAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028307
TDRKH MISSION shRNA Lentiviral Transduction Particles
tudor and KH domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028307.1-283s21c1
Sequence:CCGGGTCGACAAGGAGCCAATATTACTCGAGTAATATTGGCTCCTTGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028307.1-170s21c1
Sequence:CCGGCATTCTGTATCGTCGATATAGCTCGAGCTATATCGACGATACAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028307.1-1735s21c1
Sequence:CCGGATAACCTTGAAGACGACTTATCTCGAGATAAGTCGTCTTCAAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028307.1-580s21c1
Sequence:CCGGTACTACTCTCACGACTTATAACTCGAGTTATAAGTCGTGAGAGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028307.1-2291s21c1
Sequence:CCGGCAGATTTCTGACTCGACTTATCTCGAGATAAGTCGAGTCAGAAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006862
VALIDATED
TDRKH MISSION shRNA Bacterial Glycerol Stock
tudor and KH domain containing
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006862.3-612s21c1
Sequence:CCGGGGCGAGACAATTCGTTCTATCCTCGAGGATAGAACGAATTGTCTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006862.3-1843s21c1
Sequence:GTACCGGACCTTGAAGATGACTACTTACCTCGAGGTAAGTAGTCATCTTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006862.3-1641s21c1
Sequence:GTACCGGGTACACAAAGGATACGCAATTCTCGAGAATTGCGTATCCTTTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006862.3-1989s21c1
Sequence:CCGGTTAGAGGTTCCCTGATATAAACTCGAGTTTATATCAGGGAACCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006862.3-388s21c1
Sequence:CCGGGCCGGCAAGGAGCCAATATTACTCGAGTAATATTGGCTCCTTGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006862.2-2181s1c1
Sequence:CCGGCCCTCTTCTATGTTACCTATTCTCGAGAATAGGTAACATAGAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006862.2-2090s1c1
Sequence:CCGGGCCTTTAAGTCTTACCTGTTTCTCGAGAAACAGGTAAGACTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006862.2-1959s1c1
Sequence:CCGGGTAGGGAACCTTTACTCTTTACTCGAGTAAAGAGTAAAGGTTCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006862.2-1809s1c1
Sequence:CCGGGCTTCCATGTCTGGTGATGATCTCGAGATCATCACCAGACATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006862
VALIDATED
TDRKH MISSION shRNA shRNA Plasmid DNA
tudor and KH domain containing
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006862.3-612s21c1
Sequence:CCGGGGCGAGACAATTCGTTCTATCCTCGAGGATAGAACGAATTGTCTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006862.3-1843s21c1
Sequence:GTACCGGACCTTGAAGATGACTACTTACCTCGAGGTAAGTAGTCATCTTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006862.3-1641s21c1
Sequence:GTACCGGGTACACAAAGGATACGCAATTCTCGAGAATTGCGTATCCTTTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006862.3-1989s21c1
Sequence:CCGGTTAGAGGTTCCCTGATATAAACTCGAGTTTATATCAGGGAACCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006862.3-388s21c1
Sequence:CCGGGCCGGCAAGGAGCCAATATTACTCGAGTAATATTGGCTCCTTGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006862.2-2181s1c1
Sequence:CCGGCCCTCTTCTATGTTACCTATTCTCGAGAATAGGTAACATAGAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006862.2-2090s1c1
Sequence:CCGGGCCTTTAAGTCTTACCTGTTTCTCGAGAAACAGGTAAGACTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006862.2-1959s1c1
Sequence:CCGGGTAGGGAACCTTTACTCTTTACTCGAGTAAAGAGTAAAGGTTCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006862.2-1809s1c1
Sequence:CCGGGCTTCCATGTCTGGTGATGATCTCGAGATCATCACCAGACATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006862
VALIDATED
TDRKH MISSION shRNA Lentiviral Transduction Particles
tudor and KH domain containing
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006862.3-612s21c1
Sequence:CCGGGGCGAGACAATTCGTTCTATCCTCGAGGATAGAACGAATTGTCTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006862.3-1843s21c1
Sequence:GTACCGGACCTTGAAGATGACTACTTACCTCGAGGTAAGTAGTCATCTTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006862.3-1641s21c1
Sequence:GTACCGGGTACACAAAGGATACGCAATTCTCGAGAATTGCGTATCCTTTGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006862.3-1989s21c1
Sequence:CCGGTTAGAGGTTCCCTGATATAAACTCGAGTTTATATCAGGGAACCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006862.3-388s21c1
Sequence:CCGGGCCGGCAAGGAGCCAATATTACTCGAGTAATATTGGCTCCTTGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006862.2-2181s1c1
Sequence:CCGGCCCTCTTCTATGTTACCTATTCTCGAGAATAGGTAACATAGAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006862.2-2090s1c1
Sequence:CCGGGCCTTTAAGTCTTACCTGTTTCTCGAGAAACAGGTAAGACTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006862.2-1959s1c1
Sequence:CCGGGTAGGGAACCTTTACTCTTTACTCGAGTAAAGAGTAAAGGTTCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006862.2-1809s1c1
Sequence:CCGGGCTTCCATGTCTGGTGATGATCTCGAGATCATCACCAGACATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks