EMAIL THIS PAGE TO A FRIEND

TDRP

testis development related protein

Synonyms: C8orf42 Inm01 TDRP1 TDRP2
Species: Human TDRP(157695), Mouse Tdrp(72148), Rat Tdrp(498662), domestic guinea pig Tdrp(100723144), naked mole-rat Tdrp(101698232)
UniProtKB ID: Q86YL5, B6VF03, B9EG53
Gene ID:
Mouse(72148) testis development related protein
Rat(498662) testis development related protein
domestic guinea pig(100723144) testis development related protein
naked mole-rat(101698232) testis development related protein
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175075 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175075 Rosetta Predictions human pricing
XM_001075039 Rosetta Predictions rat pricing
XM_573943 Rosetta Predictions rat pricing
NM_173744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180757 predicted 1415
2 SASI_Hs01_00180758 predicted 1384
3 SASI_Hs01_00180759 predicted 1633
4 SASI_Hs01_00180760 predicted 1403
5 SASI_Hs01_00180762 predicted 1300
6 SASI_Hs01_00180763 predicted 1495
7 SASI_Hs01_00180764 predicted 1418
8 SASI_Hs01_00180766 predicted 1081
9 SASI_Hs02_00368985 predicted 1508
10 SASI_Hs02_00368986 predicted 1408
11 SASI_Hs01_00180761 predicted 1188
12 SASI_Hs01_00180765 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348201 predicted 1113
2 SASI_Rn02_00348202 predicted 1108
3 SASI_Rn02_00348203 predicted 283
4 SASI_Rn02_00348204 predicted 503
5 SASI_Rn02_00348205 predicted 282
6 SASI_Rn02_00348206 predicted 348
7 SASI_Rn02_00348207 predicted 318
8 SASI_Rn02_00348208 predicted 1096
9 SASI_Rn02_00348209 predicted 353
10 SASI_Rn02_00348210 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401065 predicted 1324
2 SASI_Rn02_00401066 predicted 1333
3 SASI_Rn02_00401067 predicted 500
4 SASI_Rn02_00401068 predicted 718
5 SASI_Rn02_00401069 predicted 505
6 SASI_Rn02_00401070 predicted 564
7 SASI_Rn02_00401071 predicted 540
8 SASI_Rn02_00401072 predicted 1324
9 SASI_Rn02_00401073 predicted 570
10 SASI_Rn02_00401074 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119015 predicted 1005
2 SASI_Mm01_00119016 predicted 1031
3 SASI_Mm01_00119017 predicted 1080
4 SASI_Mm01_00119019 predicted 246
5 SASI_Mm01_00119020 predicted 910
6 SASI_Mm01_00119021 predicted 642
7 SASI_Mm02_00345389 predicted 650
8 SASI_Mm01_00119022 predicted 974
9 SASI_Mm01_00119023 predicted 913
10 SASI_Mm01_00119024 predicted 794
11 SASI_Mm01_00119018 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173744
VALIDATED
TDRP MISSION shRNA Bacterial Glycerol Stock
testis development related protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173744.2-220s1c1
Sequence:CCGGCGAGACTTCCAGATCTCCTAACTCGAGTTAGGAGATCTGGAAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173744.2-1365s1c1
Sequence:CCGGGCCTCGTTTCTATTCTCAGATCTCGAGATCTGAGAATAGAAACGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173744.2-231s1c1
Sequence:CCGGGATCTCCTAAGTCCAAAGGAACTCGAGTTCCTTTGGACTTAGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173744.2-1798s1c1
Sequence:CCGGCCACCCATAAACCAAGCTATTCTCGAGAATAGCTTGGTTTATGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173744.4-306s21c1
Sequence:CCGGCGAGACTTCCAGATCTCCTAACTCGAGTTAGGAGATCTGGAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173744.4-317s21c1
Sequence:CCGGGATCTCCTAAGTCCAAAGGAACTCGAGTTCCTTTGGACTTAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173744.4-1884s21c1
Sequence:CCGGCCACCCATAAACCAAGCTATTCTCGAGAATAGCTTGGTTTATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173744.4-1451s21c1
Sequence:CCGGGCCTCGTTTCTATTCTCAGATCTCGAGATCTGAGAATAGAAACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173744
VALIDATED
TDRP MISSION shRNA shRNA Plasmid DNA
testis development related protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173744.2-220s1c1
Sequence:CCGGCGAGACTTCCAGATCTCCTAACTCGAGTTAGGAGATCTGGAAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173744.2-1365s1c1
Sequence:CCGGGCCTCGTTTCTATTCTCAGATCTCGAGATCTGAGAATAGAAACGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173744.2-231s1c1
Sequence:CCGGGATCTCCTAAGTCCAAAGGAACTCGAGTTCCTTTGGACTTAGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173744.2-1798s1c1
Sequence:CCGGCCACCCATAAACCAAGCTATTCTCGAGAATAGCTTGGTTTATGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173744.4-306s21c1
Sequence:CCGGCGAGACTTCCAGATCTCCTAACTCGAGTTAGGAGATCTGGAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173744.4-317s21c1
Sequence:CCGGGATCTCCTAAGTCCAAAGGAACTCGAGTTCCTTTGGACTTAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173744.4-1884s21c1
Sequence:CCGGCCACCCATAAACCAAGCTATTCTCGAGAATAGCTTGGTTTATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173744.4-1451s21c1
Sequence:CCGGGCCTCGTTTCTATTCTCAGATCTCGAGATCTGAGAATAGAAACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173744
VALIDATED
TDRP MISSION shRNA Lentiviral Transduction Particles
testis development related protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173744.2-220s1c1
Sequence:CCGGCGAGACTTCCAGATCTCCTAACTCGAGTTAGGAGATCTGGAAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173744.2-1365s1c1
Sequence:CCGGGCCTCGTTTCTATTCTCAGATCTCGAGATCTGAGAATAGAAACGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173744.2-231s1c1
Sequence:CCGGGATCTCCTAAGTCCAAAGGAACTCGAGTTCCTTTGGACTTAGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173744.2-1798s1c1
Sequence:CCGGCCACCCATAAACCAAGCTATTCTCGAGAATAGCTTGGTTTATGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173744.4-306s21c1
Sequence:CCGGCGAGACTTCCAGATCTCCTAACTCGAGTTAGGAGATCTGGAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173744.4-317s21c1
Sequence:CCGGGATCTCCTAAGTCCAAAGGAACTCGAGTTCCTTTGGACTTAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173744.4-1884s21c1
Sequence:CCGGCCACCCATAAACCAAGCTATTCTCGAGAATAGCTTGGTTTATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173744.4-1451s21c1
Sequence:CCGGGCCTCGTTTCTATTCTCAGATCTCGAGATCTGAGAATAGAAACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175075
VALIDATED
TDRP MISSION shRNA Bacterial Glycerol Stock
testis development related protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175075.2-1318s1c1
Sequence:CCGGGCAGGGATTGTACATTTGATTCTCGAGAATCAAATGTACAATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175075.2-777s1c1
Sequence:CCGGCAAGTCCAAAGGAACTAACTTCTCGAGAAGTTAGTTCCTTTGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_175075.3-784s21c1
Sequence:CCGGAGGAACTAACTTACGATTAAACTCGAGTTTAATCGTAAGTTAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_175075.3-712s21c1
Sequence:CCGGAGAAGTGACTTCACTGTTTAACTCGAGTTAAACAGTGAAGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175075.3-1504s21c1
Sequence:CCGGCTTGTATGTAGCACGTATAAACTCGAGTTTATACGTGCTACATACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175075.3-1076s21c1
Sequence:CCGGAGCATCCGACGGCAGAGTAAACTCGAGTTTACTCTGCCGTCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_175075.3-680s21c1
Sequence:CCGGCAGGTTCAGGGAGCAAGTTTCCTCGAGGAAACTTGCTCCCTGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175075
VALIDATED
TDRP MISSION shRNA shRNA Plasmid DNA
testis development related protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175075.2-1318s1c1
Sequence:CCGGGCAGGGATTGTACATTTGATTCTCGAGAATCAAATGTACAATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175075.2-777s1c1
Sequence:CCGGCAAGTCCAAAGGAACTAACTTCTCGAGAAGTTAGTTCCTTTGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_175075.3-784s21c1
Sequence:CCGGAGGAACTAACTTACGATTAAACTCGAGTTTAATCGTAAGTTAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_175075.3-712s21c1
Sequence:CCGGAGAAGTGACTTCACTGTTTAACTCGAGTTAAACAGTGAAGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175075.3-1504s21c1
Sequence:CCGGCTTGTATGTAGCACGTATAAACTCGAGTTTATACGTGCTACATACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175075.3-1076s21c1
Sequence:CCGGAGCATCCGACGGCAGAGTAAACTCGAGTTTACTCTGCCGTCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_175075.3-680s21c1
Sequence:CCGGCAGGTTCAGGGAGCAAGTTTCCTCGAGGAAACTTGCTCCCTGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175075
VALIDATED
TDRP MISSION shRNA Lentiviral Transduction Particles
testis development related protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175075.2-1318s1c1
Sequence:CCGGGCAGGGATTGTACATTTGATTCTCGAGAATCAAATGTACAATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175075.2-777s1c1
Sequence:CCGGCAAGTCCAAAGGAACTAACTTCTCGAGAAGTTAGTTCCTTTGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_175075.3-784s21c1
Sequence:CCGGAGGAACTAACTTACGATTAAACTCGAGTTTAATCGTAAGTTAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_175075.3-712s21c1
Sequence:CCGGAGAAGTGACTTCACTGTTTAACTCGAGTTAAACAGTGAAGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175075.3-1504s21c1
Sequence:CCGGCTTGTATGTAGCACGTATAAACTCGAGTTTATACGTGCTACATACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175075.3-1076s21c1
Sequence:CCGGAGCATCCGACGGCAGAGTAAACTCGAGTTTACTCTGCCGTCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_175075.3-680s21c1
Sequence:CCGGCAGGTTCAGGGAGCAAGTTTCCTCGAGGAAACTTGCTCCCTGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks