EMAIL THIS PAGE TO A FRIEND

TEAD1

TEA domain family member 1 (SV40 transcriptional enhancer factor)

Synonyms: AA NTEF-1 REF1 TCF-13 TCF13 TEAD-1 TEF-1
UniProtKB ID: P28347
Gene ID:
Human(7003) Summary: This gene encodes a ubiquitous transcriptional enhancer factor that is a member of the TEA/ATTS domain family. This protein directs the transactivation of a wide variety of genes and, in placental cells, also acts as a transcriptional repressor. Mutations in this gene cause Sveinsson's chorioretinal atrophy. Additional transcript variants have been described but their full-length natures have not been experimentally verified. [provided by RefSeq, May 2010]
Mouse(21676) TEA domain family member 1
Rat(361630) TEA domain family member 1
cow(536560) TEA domain family member 1 (SV40 transcriptional enhancer factor)
sheep(101120947) TEA domain family member 1 (SV40 transcriptional enhancer factor)
naked mole-rat(101715816) TEA domain family member 1 (SV40 transcriptional enhancer factor)
Domestic Rabbit(100349978) TEA domain family member 1 (SV40 transcriptional enhancer factor)
domestic guinea pig(100735625) TEA domain family member 1 (SV40 transcriptional enhancer factor)
chicken(403089) TEA domain family member 1 (SV40 transcriptional enhancer factor)
dog(610713) TEA domain family member 1 (SV40 transcriptional enhancer factor)
Horse(100071493) TEA domain family member 1 (SV40 transcriptional enhancer factor)
domestic cat(101093890) TEA domain family member 1 (SV40 transcriptional enhancer factor)
344 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009346 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009346 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009346 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021961 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021961 Rosetta Predictions human pricing
XM_001069186 Rosetta Predictions rat pricing
XM_001069278 Rosetta Predictions rat pricing
XM_001069320 Rosetta Predictions rat pricing
XM_001069362 Rosetta Predictions rat pricing
XM_001069402 Rosetta Predictions rat pricing
XM_001069451 Rosetta Predictions rat pricing
XM_001069494 Rosetta Predictions rat pricing
XM_001078008 Rosetta Predictions rat pricing
NM_009346 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031299 predicted 1592
2 SASI_Hs01_00031300 predicted 1125
3 SASI_Hs01_00031301 predicted 1546
4 SASI_Hs01_00031302 predicted 1629
5 SASI_Hs01_00031303 predicted 1656
6 SASI_Hs02_00355301 predicted 680
7 SASI_Hs01_00031306 predicted 1643
8 SASI_Hs02_00355302 predicted 1390
9 SASI_Hs02_00355303 predicted 889
10 SASI_Hs01_00031307 predicted 1684
11 SASI_Hs01_00031304 predicted 928
12 SASI_Hs01_00031305 predicted 384
13 SASI_Hs01_00031308 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327153 predicted 878
2 SASI_Rn02_00327154 predicted 1588
3 SASI_Rn02_00327155 predicted 1627
4 SASI_Rn02_00327156 predicted 1504
5 SASI_Rn02_00327157 predicted 1438
6 SASI_Rn02_00327158 predicted 1233
7 SASI_Rn02_00327159 predicted 1628
8 SASI_Rn02_00327160 predicted 1080
9 SASI_Rn02_00327161 predicted 1398
10 SASI_Rn02_00327162 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327490 predicted 1525
2 SASI_Rn02_00327491 predicted 1441
3 SASI_Rn02_00327492 predicted 1373
4 SASI_Rn02_00327493 predicted 1168
5 SASI_Rn02_00327494 predicted 1493
6 SASI_Rn02_00327495 predicted 1340
7 SASI_Rn02_00327496 predicted 1384
8 SASI_Rn02_00327497 predicted 1468
9 SASI_Rn02_00327498 predicted 1139
10 SASI_Rn02_00327499 predicted 1277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327601 predicted 885
2 SASI_Rn02_00327602 predicted 1601
3 SASI_Rn02_00327603 predicted 1516
4 SASI_Rn02_00327604 predicted 1450
5 SASI_Rn02_00327605 predicted 1241
6 SASI_Rn02_00327606 predicted 1639
7 SASI_Rn02_00327607 predicted 1090
8 SASI_Rn02_00327608 predicted 1411
9 SASI_Rn02_00327609 predicted 1462
10 SASI_Rn02_00327610 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327766 predicted 1538
2 SASI_Rn02_00327767 predicted 1389
3 SASI_Rn02_00327768 predicted 1179
4 SASI_Rn02_00327769 predicted 1507
5 SASI_Rn02_00327770 predicted 1351
6 SASI_Rn02_00327771 predicted 1397
7 SASI_Rn02_00327772 predicted 1482
8 SASI_Rn02_00327773 predicted 1145
9 SASI_Rn02_00327774 predicted 839
10 SASI_Rn02_00327775 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327857 predicted 1665
2 SASI_Rn02_00327858 predicted 1570
3 SASI_Rn02_00327859 predicted 1516
4 SASI_Rn02_00327860 predicted 1306
5 SASI_Rn02_00327861 predicted 1151
6 SASI_Rn02_00327862 predicted 882
7 SASI_Rn02_00327863 predicted 1475
8 SASI_Rn02_00327864 predicted 1522
9 SASI_Rn02_00327865 predicted 1601
10 SASI_Rn02_00327866 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328127 predicted 1605
2 SASI_Rn02_00328128 predicted 1508
3 SASI_Rn02_00328129 predicted 1445
4 SASI_Rn02_00328130 predicted 1246
5 SASI_Rn02_00328131 predicted 1641
6 SASI_Rn02_00328132 predicted 1088
7 SASI_Rn02_00328133 predicted 1413
8 SASI_Rn02_00328134 predicted 1468
9 SASI_Rn02_00328135 predicted 1539
10 SASI_Rn02_00328136 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328254 predicted 1590
2 SASI_Rn02_00328255 predicted 1433
3 SASI_Rn02_00328256 predicted 1225
4 SASI_Rn02_00328257 predicted 1553
5 SASI_Rn02_00328258 predicted 1397
6 SASI_Rn02_00328259 predicted 1452
7 SASI_Rn02_00328260 predicted 1529
8 SASI_Rn02_00328261 predicted 1195
9 SASI_Rn02_00328262 predicted 848
10 SASI_Rn02_00328263 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359346 predicted 1147
2 SASI_Rn02_00359347 predicted 1052
3 SASI_Rn02_00359348 predicted 988
4 SASI_Rn02_00359349 predicted 782
5 SASI_Rn02_00359350 predicted 1185
6 SASI_Rn02_00359351 predicted 631
7 SASI_Rn02_00359352 predicted 951
8 SASI_Rn02_00359353 predicted 1005
9 SASI_Rn02_00359354 predicted 1078
10 SASI_Rn02_00359355 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170436 predicted 1215
2 SASI_Mm01_00170437 predicted 1238
3 SASI_Mm01_00170438 predicted 1059
4 SASI_Mm02_00315927 predicted 360
5 SASI_Mm01_00170439 predicted 1178
6 SASI_Mm01_00170440 predicted 1247
7 SASI_Mm01_00170442 predicted 1124
8 SASI_Mm01_00170443 predicted 514
9 SASI_Mm01_00170444 predicted 290
10 SASI_Mm01_00170445 predicted 823
11 SASI_Mm01_00170441 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009346
VALIDATED
TEAD1 MISSION shRNA Bacterial Glycerol Stock
TEA domain family member 1 (SV40 transcriptional enhancer factor)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009346.2-285s21c1
Sequence:CCGGGGCGTCTGGAGTCCTGATATTCTCGAGAATATCAGGACTCCAGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009346.2-2087s21c1
Sequence:CCGGGCTTGGTTGAACTATCCTAATCTCGAGATTAGGATAGTTCAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009346.2-1063s21c1
Sequence:CCGGTCAAATTCTGGGCGGACTTAACTCGAGTTAAGTCCGCCCAGAATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009346.2-967s21c1
Sequence:CCGGCTGTGGACATTCGTCAGATATCTCGAGATATCTGACGAATGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009346.2-1263s21c1
Sequence:CCGGCGCTCGCCAATGTGTGAATATCTCGAGATATTCACACATTGGCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009346.2-1414s21c1
Sequence:CCGGGTGTATTTGAAGTCTCGAATACTCGAGTATTCGAGACTTCAAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009346.1-2086s1c1
Sequence:CCGGGCTTGGTTGAACTATCCTAATCTCGAGATTAGGATAGTTCAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009346.1-1264s1c1
Sequence:CCGGGCTCGCCAATGTGTGAATATACTCGAGTATATTCACACATTGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009346.1-1263s1c1
Sequence:CCGGCGCTCGCCAATGTGTGAATATCTCGAGATATTCACACATTGGCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009346.1-938s1c1
Sequence:CCGGCCATTCTTACAGTGACCCGTTCTCGAGAACGGGTCACTGTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009346.1-482s1c1
Sequence:CCGGCAGAAGGAAATCTCGTGATTTCTCGAGAAATCACGAGATTTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009346
VALIDATED
TEAD1 MISSION shRNA shRNA Plasmid DNA
TEA domain family member 1 (SV40 transcriptional enhancer factor)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009346.2-285s21c1
Sequence:CCGGGGCGTCTGGAGTCCTGATATTCTCGAGAATATCAGGACTCCAGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009346.2-2087s21c1
Sequence:CCGGGCTTGGTTGAACTATCCTAATCTCGAGATTAGGATAGTTCAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009346.2-1063s21c1
Sequence:CCGGTCAAATTCTGGGCGGACTTAACTCGAGTTAAGTCCGCCCAGAATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009346.2-967s21c1
Sequence:CCGGCTGTGGACATTCGTCAGATATCTCGAGATATCTGACGAATGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009346.2-1263s21c1
Sequence:CCGGCGCTCGCCAATGTGTGAATATCTCGAGATATTCACACATTGGCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009346.2-1414s21c1
Sequence:CCGGGTGTATTTGAAGTCTCGAATACTCGAGTATTCGAGACTTCAAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009346.1-2086s1c1
Sequence:CCGGGCTTGGTTGAACTATCCTAATCTCGAGATTAGGATAGTTCAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009346.1-1264s1c1
Sequence:CCGGGCTCGCCAATGTGTGAATATACTCGAGTATATTCACACATTGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009346.1-1263s1c1
Sequence:CCGGCGCTCGCCAATGTGTGAATATCTCGAGATATTCACACATTGGCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009346.1-938s1c1
Sequence:CCGGCCATTCTTACAGTGACCCGTTCTCGAGAACGGGTCACTGTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009346.1-482s1c1
Sequence:CCGGCAGAAGGAAATCTCGTGATTTCTCGAGAAATCACGAGATTTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009346
VALIDATED
TEAD1 MISSION shRNA Lentiviral Transduction Particles
TEA domain family member 1 (SV40 transcriptional enhancer factor)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009346.2-285s21c1
Sequence:CCGGGGCGTCTGGAGTCCTGATATTCTCGAGAATATCAGGACTCCAGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009346.2-2087s21c1
Sequence:CCGGGCTTGGTTGAACTATCCTAATCTCGAGATTAGGATAGTTCAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009346.2-1063s21c1
Sequence:CCGGTCAAATTCTGGGCGGACTTAACTCGAGTTAAGTCCGCCCAGAATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009346.2-967s21c1
Sequence:CCGGCTGTGGACATTCGTCAGATATCTCGAGATATCTGACGAATGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009346.2-1263s21c1
Sequence:CCGGCGCTCGCCAATGTGTGAATATCTCGAGATATTCACACATTGGCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009346.2-1414s21c1
Sequence:CCGGGTGTATTTGAAGTCTCGAATACTCGAGTATTCGAGACTTCAAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009346.1-2086s1c1
Sequence:CCGGGCTTGGTTGAACTATCCTAATCTCGAGATTAGGATAGTTCAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009346.1-1264s1c1
Sequence:CCGGGCTCGCCAATGTGTGAATATACTCGAGTATATTCACACATTGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009346.1-1263s1c1
Sequence:CCGGCGCTCGCCAATGTGTGAATATCTCGAGATATTCACACATTGGCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009346.1-938s1c1
Sequence:CCGGCCATTCTTACAGTGACCCGTTCTCGAGAACGGGTCACTGTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009346.1-482s1c1
Sequence:CCGGCAGAAGGAAATCTCGTGATTTCTCGAGAAATCACGAGATTTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021961
VALIDATED
TEAD1 MISSION shRNA Bacterial Glycerol Stock
TEA domain family member 1 (SV40 transcriptional enhancer factor)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021961.4-1358s21c1
Sequence:CCGGCCATTCTTACAGTGACCCATTCTCGAGAATGGGTCACTGTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_021961.4-913s21c1
Sequence:CCGGCCAGAAGGAAATCTCGTGATTCTCGAGAATCACGAGATTTCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021961.4-1724s21c1
Sequence:CCGGGCTCAAACACTTACCAGAGAACTCGAGTTCTCTGGTAAGTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021961.4-2220s21c1
Sequence:CCGGGCCCTGTTTCTAATTGTGGTACTCGAGTACCACAATTAGAAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021961.4-1661s21c1
Sequence:CCGGCCGATTTGTATACCGAATAAACTCGAGTTTATTCGGTATACAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021961.2-745s1c1
Sequence:CCGGCCAGAAGGAAATCTCGTGATTCTCGAGAATCACGAGATTTCCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021961.2-1190s1c1
Sequence:CCGGCCATTCTTACAGTGACCCATTCTCGAGAATGGGTCACTGTAAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021961.2-1556s1c1
Sequence:CCGGGCTCAAACACTTACCAGAGAACTCGAGTTCTCTGGTAAGTGTTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021961.2-1493s1c1
Sequence:CCGGCCGATTTGTATACCGAATAAACTCGAGTTTATTCGGTATACAAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021961
VALIDATED
TEAD1 MISSION shRNA shRNA Plasmid DNA
TEA domain family member 1 (SV40 transcriptional enhancer factor)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021961.4-1358s21c1
Sequence:CCGGCCATTCTTACAGTGACCCATTCTCGAGAATGGGTCACTGTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_021961.4-913s21c1
Sequence:CCGGCCAGAAGGAAATCTCGTGATTCTCGAGAATCACGAGATTTCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021961.4-1724s21c1
Sequence:CCGGGCTCAAACACTTACCAGAGAACTCGAGTTCTCTGGTAAGTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021961.4-2220s21c1
Sequence:CCGGGCCCTGTTTCTAATTGTGGTACTCGAGTACCACAATTAGAAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021961.4-1661s21c1
Sequence:CCGGCCGATTTGTATACCGAATAAACTCGAGTTTATTCGGTATACAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021961.2-745s1c1
Sequence:CCGGCCAGAAGGAAATCTCGTGATTCTCGAGAATCACGAGATTTCCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021961.2-1190s1c1
Sequence:CCGGCCATTCTTACAGTGACCCATTCTCGAGAATGGGTCACTGTAAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021961.2-1556s1c1
Sequence:CCGGGCTCAAACACTTACCAGAGAACTCGAGTTCTCTGGTAAGTGTTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021961.2-1493s1c1
Sequence:CCGGCCGATTTGTATACCGAATAAACTCGAGTTTATTCGGTATACAAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021961
VALIDATED
TEAD1 MISSION shRNA Lentiviral Transduction Particles
TEA domain family member 1 (SV40 transcriptional enhancer factor)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021961.4-1358s21c1
Sequence:CCGGCCATTCTTACAGTGACCCATTCTCGAGAATGGGTCACTGTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_021961.4-913s21c1
Sequence:CCGGCCAGAAGGAAATCTCGTGATTCTCGAGAATCACGAGATTTCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021961.4-1724s21c1
Sequence:CCGGGCTCAAACACTTACCAGAGAACTCGAGTTCTCTGGTAAGTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021961.4-2220s21c1
Sequence:CCGGGCCCTGTTTCTAATTGTGGTACTCGAGTACCACAATTAGAAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021961.4-1661s21c1
Sequence:CCGGCCGATTTGTATACCGAATAAACTCGAGTTTATTCGGTATACAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021961.2-745s1c1
Sequence:CCGGCCAGAAGGAAATCTCGTGATTCTCGAGAATCACGAGATTTCCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021961.2-1190s1c1
Sequence:CCGGCCATTCTTACAGTGACCCATTCTCGAGAATGGGTCACTGTAAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021961.2-1556s1c1
Sequence:CCGGGCTCAAACACTTACCAGAGAACTCGAGTTCTCTGGTAAGTGTTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021961.2-1493s1c1
Sequence:CCGGCCGATTTGTATACCGAATAAACTCGAGTTTATTCGGTATACAAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks