EMAIL THIS PAGE TO A FRIEND

TEAD2

TEA domain family member 2

Synonyms: ETF TEAD-2 TEF-4 TEF4
UniProtKB ID: Q15562, B4DTJ6, Q8NA25, Q96IG3
Gene ID:
Mouse(21677) TEA domain family member 2
Rat(308582) TEA domain family member 2
dog(484381) TEA domain family member 2
Horse(100051732) TEA domain family member 2
domestic cat(101098180) TEA domain family member 2
domestic guinea pig(100728501) TEA domain family member 2
naked mole-rat(101705761) TEA domain family member 2
cow(100125315) TEA domain family member 2
sheep(101105097) TEA domain family member 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0894 AQUA Peptide QLEDG[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003598 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003598 Rosetta Predictions human pricing
NM_001107512 Rosetta Predictions rat pricing
NM_011565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063412 predicted 1488
2 SASI_Hs01_00063413 predicted 1232
3 SASI_Hs01_00063414 predicted 297
4 SASI_Hs01_00063415 predicted 309
5 SASI_Hs01_00063417 predicted 1735
6 SASI_Hs01_00063418 predicted 428
7 SASI_Hs02_00335929 predicted 1350
8 SASI_Hs01_00063419 predicted 426
9 SASI_Hs02_00335930 predicted 227
10 SASI_Hs01_00063420 predicted 1489
11 SASI_Hs01_00063416 predicted 1236
12 SASI_Hs01_00063421 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229555 predicted 1370
2 SASI_Rn02_00229556 predicted 353
3 SASI_Rn02_00229557 predicted 1805
4 SASI_Rn02_00229558 predicted 1910
5 SASI_Rn02_00229559 predicted 339
6 SASI_Rn02_00229560 predicted 1657
7 SASI_Rn02_00229561 predicted 1243
8 SASI_Rn02_00229562 predicted 1715
9 SASI_Rn02_00229563 predicted 399
10 SASI_Rn02_00229564 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152021 predicted 1603
2 SASI_Mm01_00152022 predicted 1340
3 SASI_Mm01_00152023 predicted 350
4 SASI_Mm01_00152024 predicted 309
5 SASI_Mm01_00152025 predicted 1247
6 SASI_Mm01_00152026 predicted 1596
7 SASI_Mm01_00152028 predicted 1212
8 SASI_Mm01_00152029 predicted 1066
9 SASI_Mm01_00152030 predicted 1577
10 SASI_Mm02_00320940 predicted 1650
11 SASI_Mm01_00152027 predicted 1643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003598
TEAD2 MISSION shRNA Bacterial Glycerol Stock
TEA domain family member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003598.1-1496s1c1
Sequence:CCGGGCTCACCTCATGCTTCTTATTCTCGAGAATAAGAAGCATGAGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003598.1-904s1c1
Sequence:CCGGCCGGCAGATCTACGACAAATTCTCGAGAATTTGTCGTAGATCTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003598.1-414s1c1
Sequence:CCGGCCCGAAGGAAATCAAGGGAAACTCGAGTTTCCCTTGATTTCCTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003598.1-1270s1c1
Sequence:CCGGGCCTGAGCGATACATGATGAACTCGAGTTCATCATGTATCGCTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003598.1-441s1c1
Sequence:CCGGCCAAGTTGAAGGACCAGGTTTCTCGAGAAACCTGGTCCTTCAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003598.1-1894s21c1
Sequence:CCGGATGACCTGTGAGATCACAAAGCTCGAGCTTTGTGATCTCACAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003598.1-1229s21c1
Sequence:CCGGTGCGAGTACCTGGTGAATTTCCTCGAGGAAATTCACCAGGTACTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003598
TEAD2 MISSION shRNA shRNA Plasmid DNA
TEA domain family member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003598.1-1496s1c1
Sequence:CCGGGCTCACCTCATGCTTCTTATTCTCGAGAATAAGAAGCATGAGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003598.1-904s1c1
Sequence:CCGGCCGGCAGATCTACGACAAATTCTCGAGAATTTGTCGTAGATCTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003598.1-414s1c1
Sequence:CCGGCCCGAAGGAAATCAAGGGAAACTCGAGTTTCCCTTGATTTCCTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003598.1-1270s1c1
Sequence:CCGGGCCTGAGCGATACATGATGAACTCGAGTTCATCATGTATCGCTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003598.1-441s1c1
Sequence:CCGGCCAAGTTGAAGGACCAGGTTTCTCGAGAAACCTGGTCCTTCAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003598.1-1894s21c1
Sequence:CCGGATGACCTGTGAGATCACAAAGCTCGAGCTTTGTGATCTCACAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003598.1-1229s21c1
Sequence:CCGGTGCGAGTACCTGGTGAATTTCCTCGAGGAAATTCACCAGGTACTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003598
TEAD2 MISSION shRNA Lentiviral Transduction Particles
TEA domain family member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003598.1-1496s1c1
Sequence:CCGGGCTCACCTCATGCTTCTTATTCTCGAGAATAAGAAGCATGAGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003598.1-904s1c1
Sequence:CCGGCCGGCAGATCTACGACAAATTCTCGAGAATTTGTCGTAGATCTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003598.1-414s1c1
Sequence:CCGGCCCGAAGGAAATCAAGGGAAACTCGAGTTTCCCTTGATTTCCTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003598.1-1270s1c1
Sequence:CCGGGCCTGAGCGATACATGATGAACTCGAGTTCATCATGTATCGCTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003598.1-441s1c1
Sequence:CCGGCCAAGTTGAAGGACCAGGTTTCTCGAGAAACCTGGTCCTTCAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003598.1-1894s21c1
Sequence:CCGGATGACCTGTGAGATCACAAAGCTCGAGCTTTGTGATCTCACAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003598.1-1229s21c1
Sequence:CCGGTGCGAGTACCTGGTGAATTTCCTCGAGGAAATTCACCAGGTACTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011565
VALIDATED
TEAD2 MISSION shRNA Bacterial Glycerol Stock
TEA domain family member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011565.2-899s1c1
Sequence:CCGGGCGGCAGATCTACGACAAATTCTCGAGAATTTGTCGTAGATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011565.2-773s1c1
Sequence:CCGGGCTGATAGAGTTCTCAGCGTTCTCGAGAACGCTGAGAACTCTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011565.2-1567s1c1
Sequence:CCGGCCTCTTAGAAAGGAACCGGAACTCGAGTTCCGGTTCCTTTCTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011565.2-409s1c1
Sequence:CCGGCTCGAAGGAAATCGAGAGAAACTCGAGTTTCTCTCGATTTCCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011565.2-326s1c1
Sequence:CCGGCGAACTCATTGCCCGTTACATCTCGAGATGTAACGGGCAATGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-899s21c1
Sequence:CCGGGCGGCAGATCTACGACAAATTCTCGAGAATTTGTCGTAGATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-1870s21c1
Sequence:CCGGGACGTCACAACCCGAAGATAACTCGAGTTATCTTCGGGTTGTGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-1813s21c1
Sequence:CCGGTGCTTCCCACGTGTCTCATATCTCGAGATATGAGACACGTGGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-326s21c1
Sequence:CCGGCGAACTCATTGCCCGTTACATCTCGAGATGTAACGGGCAATGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-409s21c1
Sequence:CCGGCTCGAAGGAAATCGAGAGAAACTCGAGTTTCTCTCGATTTCCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011565
VALIDATED
TEAD2 MISSION shRNA shRNA Plasmid DNA
TEA domain family member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011565.2-899s1c1
Sequence:CCGGGCGGCAGATCTACGACAAATTCTCGAGAATTTGTCGTAGATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011565.2-773s1c1
Sequence:CCGGGCTGATAGAGTTCTCAGCGTTCTCGAGAACGCTGAGAACTCTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011565.2-1567s1c1
Sequence:CCGGCCTCTTAGAAAGGAACCGGAACTCGAGTTCCGGTTCCTTTCTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011565.2-409s1c1
Sequence:CCGGCTCGAAGGAAATCGAGAGAAACTCGAGTTTCTCTCGATTTCCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011565.2-326s1c1
Sequence:CCGGCGAACTCATTGCCCGTTACATCTCGAGATGTAACGGGCAATGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-899s21c1
Sequence:CCGGGCGGCAGATCTACGACAAATTCTCGAGAATTTGTCGTAGATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-1870s21c1
Sequence:CCGGGACGTCACAACCCGAAGATAACTCGAGTTATCTTCGGGTTGTGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-1813s21c1
Sequence:CCGGTGCTTCCCACGTGTCTCATATCTCGAGATATGAGACACGTGGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-326s21c1
Sequence:CCGGCGAACTCATTGCCCGTTACATCTCGAGATGTAACGGGCAATGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-409s21c1
Sequence:CCGGCTCGAAGGAAATCGAGAGAAACTCGAGTTTCTCTCGATTTCCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011565
VALIDATED
TEAD2 MISSION shRNA Lentiviral Transduction Particles
TEA domain family member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011565.2-899s1c1
Sequence:CCGGGCGGCAGATCTACGACAAATTCTCGAGAATTTGTCGTAGATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011565.2-773s1c1
Sequence:CCGGGCTGATAGAGTTCTCAGCGTTCTCGAGAACGCTGAGAACTCTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011565.2-1567s1c1
Sequence:CCGGCCTCTTAGAAAGGAACCGGAACTCGAGTTCCGGTTCCTTTCTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011565.2-409s1c1
Sequence:CCGGCTCGAAGGAAATCGAGAGAAACTCGAGTTTCTCTCGATTTCCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011565.2-326s1c1
Sequence:CCGGCGAACTCATTGCCCGTTACATCTCGAGATGTAACGGGCAATGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-899s21c1
Sequence:CCGGGCGGCAGATCTACGACAAATTCTCGAGAATTTGTCGTAGATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-1870s21c1
Sequence:CCGGGACGTCACAACCCGAAGATAACTCGAGTTATCTTCGGGTTGTGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-1813s21c1
Sequence:CCGGTGCTTCCCACGTGTCTCATATCTCGAGATATGAGACACGTGGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-326s21c1
Sequence:CCGGCGAACTCATTGCCCGTTACATCTCGAGATGTAACGGGCAATGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011565.2-409s21c1
Sequence:CCGGCTCGAAGGAAATCGAGAGAAACTCGAGTTTCTCTCGATTTCCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks