EMAIL THIS PAGE TO A FRIEND

TEAD3

TEA domain family member 3

Synonyms: DTEF-1 ETFR-1 TEAD-3 TEAD5 TEF-5 TEF5
UniProtKB ID: Q99594, O95910, Q5BJG7, Q8N6Y4
Gene ID:
Human(7005) Summary: This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is predominantly expressed in the placenta and is involved in the transactivation of the chorionic somatomammotropin-B gene enhancer. Translation of this protein is initiated at a non-AUG (AUA) start codon. [provided by RefSeq, Jul 2008]
Mouse(21678) TEA domain family member 3
Rat(294299) TEA domain family member 3
cow(513466) TEA domain family member 3
sheep(101122474) TEA domain family member 3
naked mole-rat(101707810) TEA domain family member 3
Domestic Rabbit(100359304) TEA domain family member 3
domestic guinea pig(100731215) TEA domain family member 3
chicken(395810) TEA domain family member 3
Horse(100063075) TEA domain family member 3
domestic cat(101090266) TEA domain family member 3
dog(100687643) TEA domain family member 3
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003214 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU034051 MISSION® esiRNA esiRNA targeting mouse Tead3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003214 Rosetta Predictions human pricing
NM_001098216 Rosetta Predictions rat pricing
NM_001098226 Rosetta Predictions mouse pricing
NM_011566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090157 predicted 1713
2 SASI_Hs01_00090158 predicted 1327
3 SASI_Hs01_00090159 predicted 422
4 SASI_Hs01_00090160 predicted 525
5 SASI_Hs01_00090161 predicted 636
6 SASI_Hs01_00090162 predicted 1329
7 SASI_Hs01_00090163 predicted 395
8 SASI_Hs01_00090164 predicted 1686
9 SASI_Hs01_00090165 predicted 1196
10 SASI_Hs01_00090166 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209091 predicted 968
2 SASI_Rn02_00209092 predicted 534
3 SASI_Rn02_00209093 predicted 1282
4 SASI_Rn02_00209094 predicted 1779
5 SASI_Rn02_00209095 predicted 543
6 SASI_Rn02_00209096 predicted 448
7 SASI_Rn02_00209097 predicted 425
8 SASI_Rn02_00209098 predicted 1956
9 SASI_Rn02_00209099 predicted 540
10 SASI_Rn02_00209100 predicted 1874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301287 predicted 403
2 SASI_Mm02_00301288 predicted 1370
3 SASI_Mm02_00301289 predicted 265
4 SASI_Mm02_00301290 predicted 1812
5 SASI_Mm02_00301291 predicted 377
6 SASI_Mm02_00301292 predicted 884
7 SASI_Mm02_00301293 predicted 1133
8 SASI_Mm02_00301294 predicted 487
9 SASI_Mm02_00301295 predicted 385
10 SASI_Mm02_00301296 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320941 predicted 570
2 SASI_Mm01_00089737 predicted 1542
3 SASI_Mm01_00089738 predicted 433
4 SASI_Mm01_00089739 predicted 1984
5 SASI_Mm01_00089740 predicted 533
6 SASI_Mm01_00089741 predicted 1044
7 SASI_Mm01_00089742 predicted 1294
8 SASI_Mm01_00089743 predicted 655
9 SASI_Mm01_00089744 predicted 546
10 SASI_Mm01_00089745 predicted 611
11 SASI_Mm01_00089746 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011566
VALIDATED
TEAD3 MISSION shRNA Bacterial Glycerol Stock
TEA domain family member 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011566.3-1360s21c1
Sequence:CCGGGTGCGAGTACATGATCAATTTCTCGAGAAATTGATCATGTACTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011566.3-1540s21c1
Sequence:CCGGCCACGTCTACAAGCTTGTCAACTCGAGTTGACAAGCTTGTAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011566.3-356s21c1
Sequence:CCGGCCGGACATCGAGCAGAGCTTTCTCGAGAAAGCTCTGCTCGATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011566.3-1811s21c1
Sequence:CCGGGCCTCAAGTGACACCAGAATTCTCGAGAATTCTGGTGTCACTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011566.1-1766s1c1
Sequence:CCGGGCCTCAAGTGACACCAGAATTCTCGAGAATTCTGGTGTCACTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011566.1-1495s1c1
Sequence:CCGGCCACGTCTACAAGCTTGTCAACTCGAGTTGACAAGCTTGTAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011566.1-1315s1c1
Sequence:CCGGGTGCGAGTACATGATCAATTTCTCGAGAAATTGATCATGTACTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011566.1-311s1c1
Sequence:CCGGCCGGACATCGAGCAGAGCTTTCTCGAGAAAGCTCTGCTCGATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011566.1-1087s1c1
Sequence:CCGGGAACGCTTTCTTCCTTGTCAACTCGAGTTGACAAGGAAGAAAGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011566
VALIDATED
TEAD3 MISSION shRNA shRNA Plasmid DNA
TEA domain family member 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011566.3-1360s21c1
Sequence:CCGGGTGCGAGTACATGATCAATTTCTCGAGAAATTGATCATGTACTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011566.3-1540s21c1
Sequence:CCGGCCACGTCTACAAGCTTGTCAACTCGAGTTGACAAGCTTGTAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011566.3-356s21c1
Sequence:CCGGCCGGACATCGAGCAGAGCTTTCTCGAGAAAGCTCTGCTCGATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011566.3-1811s21c1
Sequence:CCGGGCCTCAAGTGACACCAGAATTCTCGAGAATTCTGGTGTCACTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011566.1-1766s1c1
Sequence:CCGGGCCTCAAGTGACACCAGAATTCTCGAGAATTCTGGTGTCACTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011566.1-1495s1c1
Sequence:CCGGCCACGTCTACAAGCTTGTCAACTCGAGTTGACAAGCTTGTAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011566.1-1315s1c1
Sequence:CCGGGTGCGAGTACATGATCAATTTCTCGAGAAATTGATCATGTACTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011566.1-311s1c1
Sequence:CCGGCCGGACATCGAGCAGAGCTTTCTCGAGAAAGCTCTGCTCGATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011566.1-1087s1c1
Sequence:CCGGGAACGCTTTCTTCCTTGTCAACTCGAGTTGACAAGGAAGAAAGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011566
VALIDATED
TEAD3 MISSION shRNA Lentiviral Transduction Particles
TEA domain family member 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011566.3-1360s21c1
Sequence:CCGGGTGCGAGTACATGATCAATTTCTCGAGAAATTGATCATGTACTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011566.3-1540s21c1
Sequence:CCGGCCACGTCTACAAGCTTGTCAACTCGAGTTGACAAGCTTGTAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011566.3-356s21c1
Sequence:CCGGCCGGACATCGAGCAGAGCTTTCTCGAGAAAGCTCTGCTCGATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011566.3-1811s21c1
Sequence:CCGGGCCTCAAGTGACACCAGAATTCTCGAGAATTCTGGTGTCACTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011566.1-1766s1c1
Sequence:CCGGGCCTCAAGTGACACCAGAATTCTCGAGAATTCTGGTGTCACTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011566.1-1495s1c1
Sequence:CCGGCCACGTCTACAAGCTTGTCAACTCGAGTTGACAAGCTTGTAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011566.1-1315s1c1
Sequence:CCGGGTGCGAGTACATGATCAATTTCTCGAGAAATTGATCATGTACTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011566.1-311s1c1
Sequence:CCGGCCGGACATCGAGCAGAGCTTTCTCGAGAAAGCTCTGCTCGATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011566.1-1087s1c1
Sequence:CCGGGAACGCTTTCTTCCTTGTCAACTCGAGTTGACAAGGAAGAAAGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003214
VALIDATED
TEAD3 MISSION shRNA Bacterial Glycerol Stock
TEA domain family member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003214.3-1517s21c1
Sequence:CCGGCCATGTCTACAAGCTCGTCAACTCGAGTTGACGAGCTTGTAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003214.3-1202s21c1
Sequence:CCGGCTCTGCTGATAGCATGACCATCTCGAGATGGTCATGCTATCAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003214.3-447s21c1
Sequence:CCGGGAGTTGATTGCACGCTATATTCTCGAGAATATAGCGTGCAATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003214.3-1705s21c1
Sequence:CCGGGCCACTGTTCTGCGCTTTAATCTCGAGATTAAAGCGCAGAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003214.3-917s21c1
Sequence:CCGGCCTGGAGTATTCAGCCTTCATCTCGAGATGAAGGCTGAATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-1629s1c1
Sequence:CCGGGCCACTGTTCTGCGCTTTAATCTCGAGATTAAAGCGCAGAACAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-1126s1c1
Sequence:CCGGCTCTGCTGATAGCATGACCATCTCGAGATGGTCATGCTATCAGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-371s1c1
Sequence:CCGGGAGTTGATTGCACGCTATATTCTCGAGAATATAGCGTGCAATCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-841s1c1
Sequence:CCGGCCTGGAGTATTCAGCCTTCATCTCGAGATGAAGGCTGAATACTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-1441s1c1
Sequence:CCGGCCATGTCTACAAGCTCGTCAACTCGAGTTGACGAGCTTGTAGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003214
VALIDATED
TEAD3 MISSION shRNA shRNA Plasmid DNA
TEA domain family member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003214.3-1517s21c1
Sequence:CCGGCCATGTCTACAAGCTCGTCAACTCGAGTTGACGAGCTTGTAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003214.3-1202s21c1
Sequence:CCGGCTCTGCTGATAGCATGACCATCTCGAGATGGTCATGCTATCAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003214.3-447s21c1
Sequence:CCGGGAGTTGATTGCACGCTATATTCTCGAGAATATAGCGTGCAATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003214.3-1705s21c1
Sequence:CCGGGCCACTGTTCTGCGCTTTAATCTCGAGATTAAAGCGCAGAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003214.3-917s21c1
Sequence:CCGGCCTGGAGTATTCAGCCTTCATCTCGAGATGAAGGCTGAATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-1629s1c1
Sequence:CCGGGCCACTGTTCTGCGCTTTAATCTCGAGATTAAAGCGCAGAACAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-1126s1c1
Sequence:CCGGCTCTGCTGATAGCATGACCATCTCGAGATGGTCATGCTATCAGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-371s1c1
Sequence:CCGGGAGTTGATTGCACGCTATATTCTCGAGAATATAGCGTGCAATCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-841s1c1
Sequence:CCGGCCTGGAGTATTCAGCCTTCATCTCGAGATGAAGGCTGAATACTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-1441s1c1
Sequence:CCGGCCATGTCTACAAGCTCGTCAACTCGAGTTGACGAGCTTGTAGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003214
VALIDATED
TEAD3 MISSION shRNA Lentiviral Transduction Particles
TEA domain family member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003214.3-1517s21c1
Sequence:CCGGCCATGTCTACAAGCTCGTCAACTCGAGTTGACGAGCTTGTAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003214.3-1202s21c1
Sequence:CCGGCTCTGCTGATAGCATGACCATCTCGAGATGGTCATGCTATCAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003214.3-447s21c1
Sequence:CCGGGAGTTGATTGCACGCTATATTCTCGAGAATATAGCGTGCAATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003214.3-1705s21c1
Sequence:CCGGGCCACTGTTCTGCGCTTTAATCTCGAGATTAAAGCGCAGAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003214.3-917s21c1
Sequence:CCGGCCTGGAGTATTCAGCCTTCATCTCGAGATGAAGGCTGAATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-1629s1c1
Sequence:CCGGGCCACTGTTCTGCGCTTTAATCTCGAGATTAAAGCGCAGAACAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-1126s1c1
Sequence:CCGGCTCTGCTGATAGCATGACCATCTCGAGATGGTCATGCTATCAGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-371s1c1
Sequence:CCGGGAGTTGATTGCACGCTATATTCTCGAGAATATAGCGTGCAATCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-841s1c1
Sequence:CCGGCCTGGAGTATTCAGCCTTCATCTCGAGATGAAGGCTGAATACTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003214.2-1441s1c1
Sequence:CCGGCCATGTCTACAAGCTCGTCAACTCGAGTTGACGAGCTTGTAGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks