EMAIL THIS PAGE TO A FRIEND

TEAD4

TEA domain family member 4

Synonyms: EFTR-2 RTEF1 TCF13L1 TEF-3 TEF3 TEFR-1 hRTEF-1B
UniProtKB ID: Q15561, H0Y308, Q6MZR9, Q8NEV5, Q92883, Q96BK2
Gene ID:
Human(7004) Summary: This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is preferentially expressed in the skeletal muscle, and binds to the M-CAT regulatory element found in promoters of muscle-specific genes to direct their gene expression. Alternatively spliced transcripts encoding distinct isoforms, some of which are translated through the use of a non-AUG (UUG) initiation codon, have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(21679) TEA domain family member 4
Rat(683522) TEA domain family member 4
chicken(395542) TEA domain family member 4
Horse(100057619) TEA domain family member 4
domestic cat(101089948) TEA domain family member 4
dog(611826) TEA domain family member 4
domestic guinea pig(100715284) TEA domain family member 4
naked mole-rat(101714736) TEA domain family member 4
cow(526771) TEA domain family member 4
sheep(101112975) TEA domain family member 4
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003213 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011567 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011567 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011567 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU083251 MISSION® esiRNA esiRNA targeting mouse Tead4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003213 Rosetta Predictions human pricing
NM_201441 Rosetta Predictions human pricing
NM_201443 Rosetta Predictions human pricing
XM_001066346 Rosetta Predictions rat pricing
NM_001080979 Rosetta Predictions mouse pricing
NM_011567 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046458 predicted 1490
2 SASI_Hs01_00046459 predicted 1304
3 SASI_Hs01_00046460 predicted 1316
4 SASI_Hs01_00046461 predicted 1061
5 SASI_Hs01_00046462 predicted 1106
6 SASI_Hs01_00046463 predicted 1496
7 SASI_Hs02_00335246 predicted 1310
8 SASI_Hs01_00046464 predicted 1545
9 SASI_Hs01_00046465 predicted 1504
10 SASI_Hs01_00046467 predicted 1260
11 SASI_Hs01_00046466 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084860 predicted 1361
2 SASI_Hs01_00084861 predicted 1176
3 SASI_Hs01_00084862 predicted 1190
4 SASI_Hs01_00084863 predicted 931
5 SASI_Hs01_00084864 predicted 980
6 SASI_Hs01_00084865 predicted 1371
7 SASI_Hs02_00372977 predicted 1181
8 SASI_Hs01_00084866 predicted 1418
9 SASI_Hs01_00084867 predicted 1377
10 SASI_Hs01_00084869 predicted 1131
11 SASI_Hs01_00084868 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126314 predicted 1242
2 SASI_Hs01_00126315 predicted 1058
3 SASI_Hs01_00126316 predicted 1062
4 SASI_Hs01_00126317 predicted 809
5 SASI_Hs01_00126318 predicted 848
6 SASI_Hs01_00126319 predicted 1237
7 SASI_Hs02_00372981 predicted 1051
8 SASI_Hs01_00126320 predicted 1290
9 SASI_Hs01_00126321 predicted 1249
10 SASI_Hs01_00126323 predicted 1010
11 SASI_Hs01_00126322 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317135 predicted 1154
2 SASI_Rn02_00317136 predicted 535
3 SASI_Rn02_00317137 predicted 987
4 SASI_Rn02_00317138 predicted 413
5 SASI_Rn02_00317139 predicted 1109
6 SASI_Rn02_00317140 predicted 1356
7 SASI_Rn02_00317141 predicted 1685
8 SASI_Rn02_00317142 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294236 predicted 1167
2 SASI_Mm02_00294237 predicted 1550
3 SASI_Mm02_00294238 predicted 1457
4 SASI_Mm02_00294239 predicted 1696
5 SASI_Mm02_00294240 predicted 1635
6 SASI_Mm02_00294241 predicted 1912
7 SASI_Mm02_00294242 predicted 1468
8 SASI_Mm02_00294243 predicted 1512
9 SASI_Mm02_00294244 predicted 1546
10 SASI_Mm02_00294245 predicted 1464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066379 predicted 1298
2 SASI_Mm02_00320942 predicted 1674
3 SASI_Mm02_00320943 predicted 1588
4 SASI_Mm02_00320944 predicted 1819
5 SASI_Mm02_00320945 predicted 1769
6 SASI_Mm02_00320946 predicted 2040
7 SASI_Mm02_00320947 predicted 1592
8 SASI_Mm02_00320948 predicted 1645
9 SASI_Mm02_00320949 predicted 1669
10 SASI_Mm02_00320950 predicted 1596
11 SASI_Mm01_00066378 predicted 766
12 SASI_Mm01_00066380 predicted 646
13 SASI_Mm01_00066381 predicted 1025
14 SASI_Mm01_00066382 predicted 971
15 SASI_Mm01_00066383 predicted 1038
16 SASI_Mm01_00066384 predicted 929
17 SASI_Mm01_00066385 predicted 370
18 SASI_Mm01_00066386 predicted 616
19 SASI_Mm01_00066387 predicted 669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003213
VALIDATED
TEAD4 MISSION shRNA Bacterial Glycerol Stock
TEA domain family member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003213.1-1493s1c1
Sequence:CCGGGAAGAGACGTGTGTGCAGGAACTCGAGTTCCTGCACACACGTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003213.1-295s1c1
Sequence:CCGGCCCGGATATTGAGCAGAGTTTCTCGAGAAACTCTGCTCAATATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003213.1-1199s1c1
Sequence:CCGGGAGACAGAGTATGCTCGCTATCTCGAGATAGCGAGCATACTCTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003213.1-1387s1c1
Sequence:CCGGGCTGTGCATTGCCTATGTCTTCTCGAGAAGACATAGGCAATGCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003213.1-698s1c1
Sequence:CCGGCCTTTCTCTCAGCAAACCTATCTCGAGATAGGTTTGCTGAGAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003213.2-1498s21c1
Sequence:CCGGGCTGTGCATTGCCTATGTCTTCTCGAGAAGACATAGGCAATGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003213.2-366s21c1
Sequence:CCGGTGGACAAGCCCATCGACAATGCTCGAGCATTGTCGATGGGCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003213.2-607s21c1
Sequence:CCGGCGAGATCCAGGCCAAGCTAAACTCGAGTTTAGCTTGGCCTGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003213.2-809s21c1
Sequence:CCGGCCTTTCTCTCAGCAAACCTATCTCGAGATAGGTTTGCTGAGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003213.2-1310s21c1
Sequence:CCGGGAGACAGAGTATGCTCGCTATCTCGAGATAGCGAGCATACTCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003213
VALIDATED
TEAD4 MISSION shRNA shRNA Plasmid DNA
TEA domain family member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003213.1-1493s1c1
Sequence:CCGGGAAGAGACGTGTGTGCAGGAACTCGAGTTCCTGCACACACGTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003213.1-295s1c1
Sequence:CCGGCCCGGATATTGAGCAGAGTTTCTCGAGAAACTCTGCTCAATATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003213.1-1199s1c1
Sequence:CCGGGAGACAGAGTATGCTCGCTATCTCGAGATAGCGAGCATACTCTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003213.1-1387s1c1
Sequence:CCGGGCTGTGCATTGCCTATGTCTTCTCGAGAAGACATAGGCAATGCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003213.1-698s1c1
Sequence:CCGGCCTTTCTCTCAGCAAACCTATCTCGAGATAGGTTTGCTGAGAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003213.2-1498s21c1
Sequence:CCGGGCTGTGCATTGCCTATGTCTTCTCGAGAAGACATAGGCAATGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003213.2-366s21c1
Sequence:CCGGTGGACAAGCCCATCGACAATGCTCGAGCATTGTCGATGGGCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003213.2-607s21c1
Sequence:CCGGCGAGATCCAGGCCAAGCTAAACTCGAGTTTAGCTTGGCCTGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003213.2-809s21c1
Sequence:CCGGCCTTTCTCTCAGCAAACCTATCTCGAGATAGGTTTGCTGAGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003213.2-1310s21c1
Sequence:CCGGGAGACAGAGTATGCTCGCTATCTCGAGATAGCGAGCATACTCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003213
VALIDATED
TEAD4 MISSION shRNA Lentiviral Transduction Particles
TEA domain family member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003213.1-1493s1c1
Sequence:CCGGGAAGAGACGTGTGTGCAGGAACTCGAGTTCCTGCACACACGTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003213.1-295s1c1
Sequence:CCGGCCCGGATATTGAGCAGAGTTTCTCGAGAAACTCTGCTCAATATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003213.1-1199s1c1
Sequence:CCGGGAGACAGAGTATGCTCGCTATCTCGAGATAGCGAGCATACTCTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003213.1-1387s1c1
Sequence:CCGGGCTGTGCATTGCCTATGTCTTCTCGAGAAGACATAGGCAATGCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003213.1-698s1c1
Sequence:CCGGCCTTTCTCTCAGCAAACCTATCTCGAGATAGGTTTGCTGAGAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003213.2-1498s21c1
Sequence:CCGGGCTGTGCATTGCCTATGTCTTCTCGAGAAGACATAGGCAATGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003213.2-366s21c1
Sequence:CCGGTGGACAAGCCCATCGACAATGCTCGAGCATTGTCGATGGGCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003213.2-607s21c1
Sequence:CCGGCGAGATCCAGGCCAAGCTAAACTCGAGTTTAGCTTGGCCTGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003213.2-809s21c1
Sequence:CCGGCCTTTCTCTCAGCAAACCTATCTCGAGATAGGTTTGCTGAGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003213.2-1310s21c1
Sequence:CCGGGAGACAGAGTATGCTCGCTATCTCGAGATAGCGAGCATACTCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011567
VALIDATED
TEAD4 MISSION shRNA Bacterial Glycerol Stock
TEA domain family member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011567.1-780s1c1
Sequence:CCGGCCGCCAAATCTATGACAAGTTCTCGAGAACTTGTCATAGATTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011567.1-85s1c1
Sequence:CCGGGACAATGATGCAGAGGGTGTACTCGAGTACACCCTCTGCATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011567.1-654s1c1
Sequence:CCGGGATGTTGGAGTTCTCGGCTTTCTCGAGAAAGCCGAGAACTCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011567.1-1107s1c1
Sequence:CCGGGCTGAAACACTTACCCGAGAACTCGAGTTCTCGGGTAAGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011567.1-1071s1c1
Sequence:CCGGCCCTCTCTGTGAGTACATGATCTCGAGATCATGTACTCACAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-654s21c1
Sequence:CCGGGACAATGATGCAGAGGGTGTACTCGAGTACACCCTCTGCATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-1640s21c1
Sequence:CCGGCCCTCTCTGTGAGTACATGATCTCGAGATCATGTACTCACAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-1676s21c1
Sequence:CCGGGCTGAAACACTTACCCGAGAACTCGAGTTCTCGGGTAAGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-1349s21c1
Sequence:CCGGCCGCCAAATCTATGACAAGTTCTCGAGAACTTGTCATAGATTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-1223s21c1
Sequence:CCGGGATGTTGGAGTTCTCGGCTTTCTCGAGAAAGCCGAGAACTCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011567
VALIDATED
TEAD4 MISSION shRNA shRNA Plasmid DNA
TEA domain family member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011567.1-780s1c1
Sequence:CCGGCCGCCAAATCTATGACAAGTTCTCGAGAACTTGTCATAGATTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011567.1-85s1c1
Sequence:CCGGGACAATGATGCAGAGGGTGTACTCGAGTACACCCTCTGCATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011567.1-654s1c1
Sequence:CCGGGATGTTGGAGTTCTCGGCTTTCTCGAGAAAGCCGAGAACTCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011567.1-1107s1c1
Sequence:CCGGGCTGAAACACTTACCCGAGAACTCGAGTTCTCGGGTAAGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011567.1-1071s1c1
Sequence:CCGGCCCTCTCTGTGAGTACATGATCTCGAGATCATGTACTCACAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-654s21c1
Sequence:CCGGGACAATGATGCAGAGGGTGTACTCGAGTACACCCTCTGCATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-1640s21c1
Sequence:CCGGCCCTCTCTGTGAGTACATGATCTCGAGATCATGTACTCACAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-1676s21c1
Sequence:CCGGGCTGAAACACTTACCCGAGAACTCGAGTTCTCGGGTAAGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-1349s21c1
Sequence:CCGGCCGCCAAATCTATGACAAGTTCTCGAGAACTTGTCATAGATTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-1223s21c1
Sequence:CCGGGATGTTGGAGTTCTCGGCTTTCTCGAGAAAGCCGAGAACTCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011567
VALIDATED
TEAD4 MISSION shRNA Lentiviral Transduction Particles
TEA domain family member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011567.1-780s1c1
Sequence:CCGGCCGCCAAATCTATGACAAGTTCTCGAGAACTTGTCATAGATTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011567.1-85s1c1
Sequence:CCGGGACAATGATGCAGAGGGTGTACTCGAGTACACCCTCTGCATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011567.1-654s1c1
Sequence:CCGGGATGTTGGAGTTCTCGGCTTTCTCGAGAAAGCCGAGAACTCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011567.1-1107s1c1
Sequence:CCGGGCTGAAACACTTACCCGAGAACTCGAGTTCTCGGGTAAGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011567.1-1071s1c1
Sequence:CCGGCCCTCTCTGTGAGTACATGATCTCGAGATCATGTACTCACAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-654s21c1
Sequence:CCGGGACAATGATGCAGAGGGTGTACTCGAGTACACCCTCTGCATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-1640s21c1
Sequence:CCGGCCCTCTCTGTGAGTACATGATCTCGAGATCATGTACTCACAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-1676s21c1
Sequence:CCGGGCTGAAACACTTACCCGAGAACTCGAGTTCTCGGGTAAGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-1349s21c1
Sequence:CCGGCCGCCAAATCTATGACAAGTTCTCGAGAACTTGTCATAGATTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011567.2-1223s21c1
Sequence:CCGGGATGTTGGAGTTCTCGGCTTTCTCGAGAAAGCCGAGAACTCCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks