EMAIL THIS PAGE TO A FRIEND

TEC

tec protein tyrosine kinase

Synonyms: PSCTK4
UniProtKB ID: P42680, B7ZKZ6, Q3MIS5
Gene ID:
Human(7006) Summary: The protein encoded by this gene belongs to the Tec family of non-receptor protein-tyrosine kinases containing a pleckstrin homology domain. Tec family kinases are involved in the intracellular signaling mechanisms of cytokine receptors, lymphocyte surface antigens, heterotrimeric G-protein coupled receptors, and integrin molecules. They are also key players in the regulation of the immune functions. Tec kinase is an integral component of T cell signaling and has a distinct role in T cell activation. This gene may be associated with myelodysplastic syndrome. [provided by RefSeq, Jul 2008]
Human(100124696) transient erythroblastopenia of childhood
Mouse(21682) tec protein tyrosine kinase
Rat(84492) tec protein tyrosine kinase
cow(504733) tec protein tyrosine kinase
sheep(101102485) tec protein tyrosine kinase
naked mole-rat(101712372) tec protein tyrosine kinase
Domestic Rabbit(100341923) tec protein tyrosine kinase
domestic guinea pig(100722731) tec protein tyrosine kinase
Zebrafish(571588) tec protein tyrosine kinase
chicken(396407) tec protein tyrosine kinase
dog(482140) tec protein tyrosine kinase
Horse(100061381) tec protein tyrosine kinase
domestic cat(101095493) tec protein tyrosine kinase
183 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1000 Phosphotyrosine TEC / Tyrosine-protein Kinase Tec ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003215 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001113464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001113464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001113464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003215 Rosetta Predictions human pricing
NM_053432 Rosetta Predictions rat pricing
NM_001113460 Rosetta Predictions mouse pricing
NM_001113461 Rosetta Predictions mouse pricing
NM_001113464 Rosetta Predictions mouse pricing
NM_013689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169213 predicted 1016
2 SASI_Hs01_00169214 predicted 780
3 SASI_Hs01_00169215 predicted 1559
4 SASI_Hs01_00169217 predicted 204
5 SASI_Hs02_00335247 predicted 1649
6 SASI_Hs02_00335248 predicted 1848
7 SASI_Hs01_00169219 predicted 1358
8 SASI_Hs01_00169220 predicted 1860
9 SASI_Hs01_00169221 predicted 339
10 SASI_Hs01_00169222 predicted 1835
11 SASI_Hs01_00169216 predicted 785
12 SASI_Hs01_00169218 predicted 2007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053432 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265991 predicted 1928
2 SASI_Rn02_00265992 predicted 835
3 SASI_Rn02_00265993 predicted 1139
4 SASI_Rn02_00265994 predicted 779
5 SASI_Rn02_00265995 predicted 1537
6 SASI_Rn02_00265996 predicted 879
7 SASI_Rn02_00265997 predicted 504
8 SASI_Rn02_00265998 predicted 842
9 SASI_Rn02_00265999 predicted 703
10 SASI_Rn02_00266000 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307906 predicted 1398
2 SASI_Mm02_00307907 predicted 1491
3 SASI_Mm02_00307908 predicted 1658
4 SASI_Mm02_00307909 predicted 436
5 SASI_Mm02_00307910 predicted 1402
6 SASI_Mm02_00307911 predicted 2092
7 SASI_Mm02_00307912 predicted 518
8 SASI_Mm02_00307913 predicted 2148
9 SASI_Mm02_00307914 predicted 572
10 SASI_Mm02_00307915 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307916 predicted 1335
2 SASI_Mm02_00307917 predicted 1426
3 SASI_Mm02_00307918 predicted 1594
4 SASI_Mm02_00307919 predicted 442
5 SASI_Mm02_00307920 predicted 1345
6 SASI_Mm02_00307921 predicted 2027
7 SASI_Mm02_00307922 predicted 517
8 SASI_Mm02_00307923 predicted 2086
9 SASI_Mm02_00307924 predicted 571
10 SASI_Mm02_00307925 predicted 1664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307926 predicted 1314
2 SASI_Mm02_00307927 predicted 1401
3 SASI_Mm02_00307928 predicted 1569
4 SASI_Mm02_00307929 predicted 352
5 SASI_Mm02_00307930 predicted 1315
6 SASI_Mm02_00307931 predicted 1999
7 SASI_Mm02_00307932 predicted 437
8 SASI_Mm02_00307933 predicted 2069
9 SASI_Mm02_00307934 predicted 486
10 SASI_Mm02_00307935 predicted 1636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061336 predicted 2039
2 SASI_Mm01_00061337 predicted 1331
3 SASI_Mm01_00061338 predicted 1429
4 SASI_Mm01_00061339 predicted 1588
5 SASI_Mm01_00061340 predicted 1877
6 SASI_Mm01_00061341 predicted 1006
7 SASI_Mm01_00061342 predicted 836
8 SASI_Mm01_00061343 predicted 996
9 SASI_Mm01_00061344 predicted 766
10 SASI_Mm01_00061345 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003215
VALIDATED
TEC MISSION shRNA Bacterial Glycerol Stock
tec protein tyrosine kinase
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003215.2-1928s21c1
Sequence:CCGGGAAGATCTGCTGCGCACAATACTCGAGTATTGTGCGCAGCAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003215.2-1169s21c1
Sequence:CCGGTATGAGAAATGGGAGATTAACCTCGAGGTTAATCTCCCATTTCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003215.2-934s21c1
Sequence:CCGGCACAGTCTCCCTTTATACCAACTCGAGTTGGTATAAAGGGAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003215.2-1260s21c1
Sequence:CCGGGAGCCCAGTACAAAGTCGCAACTCGAGTTGCGACTTTGTACTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_003215.2-2414s21c1
Sequence:CCGGCCTGAGACATTGTCTACAATTCTCGAGAATTGTAGACAATGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.x-1412s1c1
Sequence:CCGGGCACCCAGCAGAAACCAATATCTCGAGATATTGGTTTCTGCTGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003215.x-347s1c1
Sequence:CCGGAGTATCCATTTCAGGTTGTTCCTCGAGGAACAACCTGAAATGGATACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.x-1286s1c1
Sequence:CCGGGAGCCCAGTACAAAGTCGCAACTCGAGTTGCGACTTTGTACTGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.x-960s1c1
Sequence:CCGGCACAGTCTCCCTTTATACCAACTCGAGTTGGTATAAAGGGAGACTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003215.x-895s1c1
Sequence:CCGGCTCCTCCGCAGTGAAGATAAACTCGAGTTTATCTTCACTGCGGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.1-1954s1c1
Sequence:CCGGGAAGATCTGCTGCGCACAATACTCGAGTATTGTGCGCAGCAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003215.1-793s1c1
Sequence:CCGGGAAGGATATATCCCAAGTAATCTCGAGATTACTTGGGATATATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.1-2440s1c1
Sequence:CCGGCCTGAGACATTGTCTACAATTCTCGAGAATTGTAGACAATGTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.1-2414s1c1
Sequence:CCGGCCCTTTGACTTCTACAGAAATCTCGAGATTTCTGTAGAAGTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003215.1-1965s1c1
Sequence:CCGGGCGCACAATAGATGAACTAGTCTCGAGACTAGTTCATCTATTGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003215.1-2207s1c1
Sequence:CCGGGCCTTAGAAATGGTGATTAAACTCGAGTTTAATCACCATTTCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003215
VALIDATED
TEC MISSION shRNA shRNA Plasmid DNA
tec protein tyrosine kinase
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003215.2-1928s21c1
Sequence:CCGGGAAGATCTGCTGCGCACAATACTCGAGTATTGTGCGCAGCAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003215.2-1169s21c1
Sequence:CCGGTATGAGAAATGGGAGATTAACCTCGAGGTTAATCTCCCATTTCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003215.2-934s21c1
Sequence:CCGGCACAGTCTCCCTTTATACCAACTCGAGTTGGTATAAAGGGAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003215.2-1260s21c1
Sequence:CCGGGAGCCCAGTACAAAGTCGCAACTCGAGTTGCGACTTTGTACTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_003215.2-2414s21c1
Sequence:CCGGCCTGAGACATTGTCTACAATTCTCGAGAATTGTAGACAATGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.x-1412s1c1
Sequence:CCGGGCACCCAGCAGAAACCAATATCTCGAGATATTGGTTTCTGCTGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003215.x-347s1c1
Sequence:CCGGAGTATCCATTTCAGGTTGTTCCTCGAGGAACAACCTGAAATGGATACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.x-1286s1c1
Sequence:CCGGGAGCCCAGTACAAAGTCGCAACTCGAGTTGCGACTTTGTACTGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.x-960s1c1
Sequence:CCGGCACAGTCTCCCTTTATACCAACTCGAGTTGGTATAAAGGGAGACTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003215.x-895s1c1
Sequence:CCGGCTCCTCCGCAGTGAAGATAAACTCGAGTTTATCTTCACTGCGGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.1-1954s1c1
Sequence:CCGGGAAGATCTGCTGCGCACAATACTCGAGTATTGTGCGCAGCAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003215.1-793s1c1
Sequence:CCGGGAAGGATATATCCCAAGTAATCTCGAGATTACTTGGGATATATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.1-2440s1c1
Sequence:CCGGCCTGAGACATTGTCTACAATTCTCGAGAATTGTAGACAATGTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.1-2414s1c1
Sequence:CCGGCCCTTTGACTTCTACAGAAATCTCGAGATTTCTGTAGAAGTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003215.1-1965s1c1
Sequence:CCGGGCGCACAATAGATGAACTAGTCTCGAGACTAGTTCATCTATTGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003215.1-2207s1c1
Sequence:CCGGGCCTTAGAAATGGTGATTAAACTCGAGTTTAATCACCATTTCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003215
VALIDATED
TEC MISSION shRNA Lentiviral Transduction Particles
tec protein tyrosine kinase
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003215.2-1928s21c1
Sequence:CCGGGAAGATCTGCTGCGCACAATACTCGAGTATTGTGCGCAGCAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003215.2-1169s21c1
Sequence:CCGGTATGAGAAATGGGAGATTAACCTCGAGGTTAATCTCCCATTTCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003215.2-934s21c1
Sequence:CCGGCACAGTCTCCCTTTATACCAACTCGAGTTGGTATAAAGGGAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003215.2-1260s21c1
Sequence:CCGGGAGCCCAGTACAAAGTCGCAACTCGAGTTGCGACTTTGTACTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_003215.2-2414s21c1
Sequence:CCGGCCTGAGACATTGTCTACAATTCTCGAGAATTGTAGACAATGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.x-1412s1c1
Sequence:CCGGGCACCCAGCAGAAACCAATATCTCGAGATATTGGTTTCTGCTGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003215.x-347s1c1
Sequence:CCGGAGTATCCATTTCAGGTTGTTCCTCGAGGAACAACCTGAAATGGATACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.x-1286s1c1
Sequence:CCGGGAGCCCAGTACAAAGTCGCAACTCGAGTTGCGACTTTGTACTGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.x-960s1c1
Sequence:CCGGCACAGTCTCCCTTTATACCAACTCGAGTTGGTATAAAGGGAGACTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003215.x-895s1c1
Sequence:CCGGCTCCTCCGCAGTGAAGATAAACTCGAGTTTATCTTCACTGCGGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.1-1954s1c1
Sequence:CCGGGAAGATCTGCTGCGCACAATACTCGAGTATTGTGCGCAGCAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003215.1-793s1c1
Sequence:CCGGGAAGGATATATCCCAAGTAATCTCGAGATTACTTGGGATATATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.1-2440s1c1
Sequence:CCGGCCTGAGACATTGTCTACAATTCTCGAGAATTGTAGACAATGTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003215.1-2414s1c1
Sequence:CCGGCCCTTTGACTTCTACAGAAATCTCGAGATTTCTGTAGAAGTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003215.1-1965s1c1
Sequence:CCGGGCGCACAATAGATGAACTAGTCTCGAGACTAGTTCATCTATTGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003215.1-2207s1c1
Sequence:CCGGGCCTTAGAAATGGTGATTAAACTCGAGTTTAATCACCATTTCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001113464
TEC MISSION shRNA Bacterial Glycerol Stock
tec protein tyrosine kinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113464.1-1949s21c1
Sequence:CCGGCGTACGATAGATGAACTAGTTCTCGAGAACTAGTTCATCTATCGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113464.1-745s21c1
Sequence:CCGGTTGGTGGAGAGCGAGAGATAACTCGAGTTATCTCTCGCTCTCCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113464.1-981s21c1
Sequence:CCGGCATCAGGTTTCAGGCATTATCCTCGAGGATAATGCCTGAAACCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113464.1-1165s21c1
Sequence:CCGGTGCCGGCTTCAGCTATGATAACTCGAGTTATCATAGCTGAAGCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113464.1-2034s21c1
Sequence:CCGGGTGTGCCATCGGAACGCAATTCTCGAGAATTGCGTTCCGATGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001113464
TEC MISSION shRNA shRNA Plasmid DNA
tec protein tyrosine kinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113464.1-1949s21c1
Sequence:CCGGCGTACGATAGATGAACTAGTTCTCGAGAACTAGTTCATCTATCGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113464.1-745s21c1
Sequence:CCGGTTGGTGGAGAGCGAGAGATAACTCGAGTTATCTCTCGCTCTCCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113464.1-981s21c1
Sequence:CCGGCATCAGGTTTCAGGCATTATCCTCGAGGATAATGCCTGAAACCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113464.1-1165s21c1
Sequence:CCGGTGCCGGCTTCAGCTATGATAACTCGAGTTATCATAGCTGAAGCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113464.1-2034s21c1
Sequence:CCGGGTGTGCCATCGGAACGCAATTCTCGAGAATTGCGTTCCGATGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001113464
TEC MISSION shRNA Lentiviral Transduction Particles
tec protein tyrosine kinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113464.1-1949s21c1
Sequence:CCGGCGTACGATAGATGAACTAGTTCTCGAGAACTAGTTCATCTATCGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113464.1-745s21c1
Sequence:CCGGTTGGTGGAGAGCGAGAGATAACTCGAGTTATCTCTCGCTCTCCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113464.1-981s21c1
Sequence:CCGGCATCAGGTTTCAGGCATTATCCTCGAGGATAATGCCTGAAACCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113464.1-1165s21c1
Sequence:CCGGTGCCGGCTTCAGCTATGATAACTCGAGTTATCATAGCTGAAGCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113464.1-2034s21c1
Sequence:CCGGGTGTGCCATCGGAACGCAATTCTCGAGAATTGCGTTCCGATGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013689
VALIDATED
TEC MISSION shRNA Bacterial Glycerol Stock
tec protein tyrosine kinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013689.2-1589s1c1
Sequence:CCGGGCCAGAAATTGTCTAGTGAATCTCGAGATTCACTAGACAATTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013689.2-484s1c1
Sequence:CCGGCCGATGGGTGAAGAAGTTAAACTCGAGTTTAACTTCTTCACCCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013689.2-1807s1c1
Sequence:CCGGGCCCTTTGAGAAGAACACCAACTCGAGTTGGTGTTCTTCTCAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013689.2-962s1c1
Sequence:CCGGGTCTCCCTTTACACAAAGTTTCTCGAGAAACTTTGTGTAAAGGGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013689.2-1964s1c1
Sequence:CCGGCGTACGATAGATGAACTAGTTCTCGAGAACTAGTTCATCTATCGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013689
VALIDATED
TEC MISSION shRNA shRNA Plasmid DNA
tec protein tyrosine kinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013689.2-1589s1c1
Sequence:CCGGGCCAGAAATTGTCTAGTGAATCTCGAGATTCACTAGACAATTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013689.2-484s1c1
Sequence:CCGGCCGATGGGTGAAGAAGTTAAACTCGAGTTTAACTTCTTCACCCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013689.2-1807s1c1
Sequence:CCGGGCCCTTTGAGAAGAACACCAACTCGAGTTGGTGTTCTTCTCAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013689.2-962s1c1
Sequence:CCGGGTCTCCCTTTACACAAAGTTTCTCGAGAAACTTTGTGTAAAGGGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013689.2-1964s1c1
Sequence:CCGGCGTACGATAGATGAACTAGTTCTCGAGAACTAGTTCATCTATCGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013689
VALIDATED
TEC MISSION shRNA Lentiviral Transduction Particles
tec protein tyrosine kinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013689.2-1589s1c1
Sequence:CCGGGCCAGAAATTGTCTAGTGAATCTCGAGATTCACTAGACAATTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013689.2-484s1c1
Sequence:CCGGCCGATGGGTGAAGAAGTTAAACTCGAGTTTAACTTCTTCACCCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013689.2-1807s1c1
Sequence:CCGGGCCCTTTGAGAAGAACACCAACTCGAGTTGGTGTTCTTCTCAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013689.2-962s1c1
Sequence:CCGGGTCTCCCTTTACACAAAGTTTCTCGAGAAACTTTGTGTAAAGGGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013689.2-1964s1c1
Sequence:CCGGCGTACGATAGATGAACTAGTTCTCGAGAACTAGTTCATCTATCGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks