EMAIL THIS PAGE TO A FRIEND

TECPR1

tectonin beta-propeller repeat containing 1

Gene ID:
Human(25851) Summary: This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
Mouse(70381) tectonin beta-propeller repeat containing 1
Rat(304285) tectonin beta-propeller repeat containing 1
Zebrafish(100151338) tectonin beta-propeller repeat containing 1
chicken(416436) tectonin beta-propeller repeat containing 1
domestic cat(101081853) tectonin beta-propeller repeat containing 1
dog(489868) tectonin beta-propeller repeat containing 1
domestic guinea pig(100715411) tectonin beta-propeller repeat containing 1
naked mole-rat(101716786) tectonin beta-propeller repeat containing 1
cow(789454) tectonin beta-propeller repeat containing 1
sheep(101104628) tectonin beta-propeller repeat containing 1
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015395 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104191 MISSION® esiRNA esiRNA human AC091654.4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015395 Rosetta Predictions human pricing
NM_001037191 Rosetta Predictions rat pricing
NM_027410 Rosetta Predictions mouse pricing
XM_149712 Rosetta Predictions mouse pricing
XM_899644 Rosetta Predictions mouse pricing
XM_899648 Rosetta Predictions mouse pricing
XM_899658 Rosetta Predictions mouse pricing
XM_899672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347753 predicted 1480
2 SASI_Hs01_00021232 predicted 630
3 SASI_Hs01_00021233 predicted 2626
4 SASI_Hs01_00021234 predicted 369
5 SASI_Hs01_00021235 predicted 3420
6 SASI_Hs01_00021236 predicted 647
7 SASI_Hs01_00021237 predicted 2573
8 SASI_Hs01_00021238 predicted 1200
9 SASI_Hs01_00021239 predicted 349
10 SASI_Hs02_00347754 predicted 656
11 SASI_Hs01_00021230 predicted 1687
12 SASI_Hs01_00021231 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074486 predicted 2760
2 SASI_Rn02_00204286 predicted 1341
3 SASI_Rn01_00074488 predicted 1356
4 SASI_Rn01_00074489 predicted 1710
5 SASI_Rn01_00074490 predicted 1552
6 SASI_Rn01_00074491 predicted 2903
7 SASI_Rn01_00074492 predicted 3294
8 SASI_Rn01_00074494 predicted 1192
9 SASI_Rn01_00074495 predicted 461
10 SASI_Rn02_00204287 predicted 2178
11 SASI_Rn01_00074487 predicted 503
12 SASI_Rn01_00074493 predicted 2348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332136 predicted 725
2 SASI_Mm02_00332137 predicted 2666
3 SASI_Mm02_00332138 predicted 3317
4 SASI_Mm02_00332139 predicted 3642
5 SASI_Mm02_00332140 predicted 3572
6 SASI_Mm02_00332141 predicted 506
7 SASI_Mm02_00332142 predicted 2546
8 SASI_Mm02_00332143 predicted 3092
9 SASI_Mm02_00332144 predicted 2378
10 SASI_Mm02_00332145 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_149712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216808 predicted 2910
2 SASI_Mm01_00216809 predicted 3559
3 SASI_Mm01_00216810 predicted 3009
4 SASI_Mm01_00216811 predicted 4143
5 SASI_Mm01_00216812 predicted 3613
6 SASI_Mm01_00216813 predicted 3206
7 SASI_Mm01_00216814 predicted 2794
8 SASI_Mm01_00216815 predicted 2717
9 SASI_Mm01_00216816 predicted 3030
10 SASI_Mm01_00216817 predicted 3337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232545 predicted 1925
2 SASI_Mm01_00232546 predicted 1719
3 SASI_Mm01_00232547 predicted 1972
4 SASI_Mm01_00232548 predicted 1820
5 SASI_Mm01_00232549 predicted 1978
6 SASI_Mm01_00232550 predicted 1975
7 SASI_Mm01_00232551 predicted 1811
8 SASI_Mm01_00232552 predicted 2081
9 SASI_Mm01_00232553 predicted 1755
10 SASI_Mm01_00232554 predicted 1804
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250353 predicted 765
2 SASI_Mm01_00250354 predicted 751
3 SASI_Mm01_00250355 predicted 1383
4 SASI_Mm01_00250356 predicted 692
5 SASI_Mm01_00250357 predicted 607
6 SASI_Mm01_00250358 predicted 333
7 SASI_Mm01_00250359 predicted 1279
8 SASI_Mm01_00250360 predicted 550
9 SASI_Mm01_00250361 predicted 1109
10 SASI_Mm01_00250362 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239356 predicted 974
2 SASI_Mm01_00239357 predicted 955
3 SASI_Mm01_00239358 predicted 1137
4 SASI_Mm01_00239359 predicted 1034
5 SASI_Mm01_00239360 predicted 985
6 SASI_Mm01_00239361 predicted 983
7 SASI_Mm01_00239362 predicted 1116
8 SASI_Mm01_00239363 predicted 1132
9 SASI_Mm01_00239364 predicted 950
10 SASI_Mm01_00239365 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255897 predicted 2654
2 SASI_Mm01_00255898 predicted 3312
3 SASI_Mm01_00255899 predicted 2759
4 SASI_Mm01_00255900 predicted 3880
5 SASI_Mm01_00255901 predicted 3359
6 SASI_Mm01_00255902 predicted 2950
7 SASI_Mm01_00255903 predicted 2541
8 SASI_Mm01_00255904 predicted 2461
9 SASI_Mm01_00255905 predicted 2786
10 SASI_Mm01_00255906 predicted 3077
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015395
VALIDATED
TECPR1 MISSION shRNA Bacterial Glycerol Stock
tectonin beta-propeller repeat containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167669    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015395.1-4195s1c1
Sequence:CCGGGCAAAGAGGCTTTAATTTCAACTCGAGTTGAAATTAAAGCCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015395.1-2171s1c1
Sequence:CCGGGAGAAGAAGTACATCCACATACTCGAGTATGTGGATGTACTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015395.1-1565s1c1
Sequence:CCGGGCAGAAGATACCGTGGAAGATCTCGAGATCTTCCACGGTATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015395.1-4174s1c1
Sequence:CCGGCCATTTCTCAGAGCAGGACTTCTCGAGAAGTCCTGCTCTGAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015395.1-1033s1c1
Sequence:CCGGCAAAGGAAGTTCCTGGTCCATCTCGAGATGGACCAGGAACTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-617s21c1
Sequence:CCGGTGGACGTACGCCATCGACTTTCTCGAGAAAGTCGATGGCGTACGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-1656s21c1
Sequence:CCGGAGCTGCCCTGGACCAATATTGCTCGAGCAATATTGGTCCAGGGCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-3470s21c1
Sequence:CCGGGTCTGGGTGATCGCCAACAAACTCGAGTTTGTTGGCGATCACCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-1495s21c1
Sequence:CCGGTGCAGAACCTCTAGACGATTCCTCGAGGAATCGTCTAGAGGTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-357s21c1
Sequence:CCGGACAACCAGGTCTACGTGTATGCTCGAGCATACACGTAGACCTGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-2658s21c1
Sequence:CCGGTGAAGTGTGTTCACATCTATGCTCGAGCATAGATGTGAACACACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-419s21c1
Sequence:CCGGTATGAGAATCAGCGCTGGAATCTCGAGATTCCAGCGCTGATTCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-694s21c1
Sequence:CCGGGATCCGGTACAGGAGATACAACTCGAGTTGTATCTCCTGTACCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015395
VALIDATED
TECPR1 MISSION shRNA shRNA Plasmid DNA
tectonin beta-propeller repeat containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167669    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015395.1-4195s1c1
Sequence:CCGGGCAAAGAGGCTTTAATTTCAACTCGAGTTGAAATTAAAGCCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015395.1-2171s1c1
Sequence:CCGGGAGAAGAAGTACATCCACATACTCGAGTATGTGGATGTACTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015395.1-1565s1c1
Sequence:CCGGGCAGAAGATACCGTGGAAGATCTCGAGATCTTCCACGGTATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015395.1-4174s1c1
Sequence:CCGGCCATTTCTCAGAGCAGGACTTCTCGAGAAGTCCTGCTCTGAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015395.1-1033s1c1
Sequence:CCGGCAAAGGAAGTTCCTGGTCCATCTCGAGATGGACCAGGAACTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-617s21c1
Sequence:CCGGTGGACGTACGCCATCGACTTTCTCGAGAAAGTCGATGGCGTACGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-1656s21c1
Sequence:CCGGAGCTGCCCTGGACCAATATTGCTCGAGCAATATTGGTCCAGGGCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-3470s21c1
Sequence:CCGGGTCTGGGTGATCGCCAACAAACTCGAGTTTGTTGGCGATCACCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-1495s21c1
Sequence:CCGGTGCAGAACCTCTAGACGATTCCTCGAGGAATCGTCTAGAGGTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-357s21c1
Sequence:CCGGACAACCAGGTCTACGTGTATGCTCGAGCATACACGTAGACCTGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-2658s21c1
Sequence:CCGGTGAAGTGTGTTCACATCTATGCTCGAGCATAGATGTGAACACACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-419s21c1
Sequence:CCGGTATGAGAATCAGCGCTGGAATCTCGAGATTCCAGCGCTGATTCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-694s21c1
Sequence:CCGGGATCCGGTACAGGAGATACAACTCGAGTTGTATCTCCTGTACCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015395
VALIDATED
TECPR1 MISSION shRNA Lentiviral Transduction Particles
tectonin beta-propeller repeat containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167669    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015395.1-4195s1c1
Sequence:CCGGGCAAAGAGGCTTTAATTTCAACTCGAGTTGAAATTAAAGCCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015395.1-2171s1c1
Sequence:CCGGGAGAAGAAGTACATCCACATACTCGAGTATGTGGATGTACTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015395.1-1565s1c1
Sequence:CCGGGCAGAAGATACCGTGGAAGATCTCGAGATCTTCCACGGTATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015395.1-4174s1c1
Sequence:CCGGCCATTTCTCAGAGCAGGACTTCTCGAGAAGTCCTGCTCTGAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015395.1-1033s1c1
Sequence:CCGGCAAAGGAAGTTCCTGGTCCATCTCGAGATGGACCAGGAACTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-617s21c1
Sequence:CCGGTGGACGTACGCCATCGACTTTCTCGAGAAAGTCGATGGCGTACGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-1656s21c1
Sequence:CCGGAGCTGCCCTGGACCAATATTGCTCGAGCAATATTGGTCCAGGGCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-3470s21c1
Sequence:CCGGGTCTGGGTGATCGCCAACAAACTCGAGTTTGTTGGCGATCACCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-1495s21c1
Sequence:CCGGTGCAGAACCTCTAGACGATTCCTCGAGGAATCGTCTAGAGGTTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-357s21c1
Sequence:CCGGACAACCAGGTCTACGTGTATGCTCGAGCATACACGTAGACCTGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-2658s21c1
Sequence:CCGGTGAAGTGTGTTCACATCTATGCTCGAGCATAGATGTGAACACACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-419s21c1
Sequence:CCGGTATGAGAATCAGCGCTGGAATCTCGAGATTCCAGCGCTGATTCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015395.1-694s21c1
Sequence:CCGGGATCCGGTACAGGAGATACAACTCGAGTTGTATCTCCTGTACCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027410
VALIDATED
TECPR1 MISSION shRNA Bacterial Glycerol Stock
tectonin beta-propeller repeat containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027410.1-585s21c1
Sequence:CCGGTCCGGTATAGGCGATACAAATCTCGAGATTTGTATCGCCTATACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027410.1-1568s21c1
Sequence:CCGGTGGACCAACATTGACCTAAAGCTCGAGCTTTAGGTCAATGTTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027410.1-2773s21c1
Sequence:CCGGATGGCAGTATGCCAGCGATTTCTCGAGAAATCGCTGGCATACTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027410.1-2042s21c1
Sequence:CCGGAGCATCCTCTTCATCTATTATCTCGAGATAATAGATGAAGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027410.1-3704s21c1
Sequence:CCGGTCAGGTCAGAGTCAGCCATTTCTCGAGAAATGGCTGACTCTGACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027410
VALIDATED
TECPR1 MISSION shRNA shRNA Plasmid DNA
tectonin beta-propeller repeat containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027410.1-585s21c1
Sequence:CCGGTCCGGTATAGGCGATACAAATCTCGAGATTTGTATCGCCTATACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027410.1-1568s21c1
Sequence:CCGGTGGACCAACATTGACCTAAAGCTCGAGCTTTAGGTCAATGTTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027410.1-2773s21c1
Sequence:CCGGATGGCAGTATGCCAGCGATTTCTCGAGAAATCGCTGGCATACTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027410.1-2042s21c1
Sequence:CCGGAGCATCCTCTTCATCTATTATCTCGAGATAATAGATGAAGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027410.1-3704s21c1
Sequence:CCGGTCAGGTCAGAGTCAGCCATTTCTCGAGAAATGGCTGACTCTGACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027410
VALIDATED
TECPR1 MISSION shRNA Lentiviral Transduction Particles
tectonin beta-propeller repeat containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027410.1-585s21c1
Sequence:CCGGTCCGGTATAGGCGATACAAATCTCGAGATTTGTATCGCCTATACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027410.1-1568s21c1
Sequence:CCGGTGGACCAACATTGACCTAAAGCTCGAGCTTTAGGTCAATGTTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027410.1-2773s21c1
Sequence:CCGGATGGCAGTATGCCAGCGATTTCTCGAGAAATCGCTGGCATACTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027410.1-2042s21c1
Sequence:CCGGAGCATCCTCTTCATCTATTATCTCGAGATAATAGATGAAGAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027410.1-3704s21c1
Sequence:CCGGTCAGGTCAGAGTCAGCCATTTCTCGAGAAATGGCTGACTCTGACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks