EMAIL THIS PAGE TO A FRIEND

TECPR2

tectonin beta-propeller repeat containing 2

Synonyms: KIAA0329 SPG49
UniProtKB ID: O15040, A5PKY3, A6NFY9, A7E2X3, H0YMM9, Q9UEG6
Gene ID:
Mouse(104859) tectonin beta-propeller repeat containing 2
Rat(314456) tectonin beta-propeller repeat containing 2
Zebrafish(569212) tectonin beta-propeller repeat containing 2
chicken(423468) tectonin beta-propeller repeat containing 2
domestic cat(101096488) tectonin beta-propeller repeat containing 2
Horse(100058537) tectonin beta-propeller repeat containing 2
dog(490864) tectonin beta-propeller repeat containing 2
cow(530121) tectonin beta-propeller repeat containing 2
sheep(101121714) tectonin beta-propeller repeat containing 2
naked mole-rat(101720478) tectonin beta-propeller repeat containing 2
Domestic Rabbit(100355983) tectonin beta-propeller repeat containing 2
domestic guinea pig(100720842) tectonin beta-propeller repeat containing 2
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA000658 Anti-TECPR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014844 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014844 Rosetta Predictions human pricing
XM_001071398 Rosetta Predictions rat pricing
XM_234543 Rosetta Predictions rat pricing
NM_001081057 Rosetta Predictions mouse pricing
XM_127142 Rosetta Predictions mouse pricing
XM_894845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024260 predicted 828
2 SASI_Hs01_00024262 predicted 494
3 SASI_Hs01_00024263 predicted 890
4 SASI_Hs02_00346401 predicted 3165
5 SASI_Hs01_00024265 predicted 3259
6 SASI_Hs01_00024266 predicted 2879
7 SASI_Hs01_00024267 predicted 2545
8 SASI_Hs01_00024268 predicted 2961
9 SASI_Hs01_00024269 predicted 2247
10 SASI_Hs02_00346402 predicted 376
11 SASI_Hs01_00024261 predicted 3825
12 SASI_Hs01_00024264 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334977 predicted 3427
2 SASI_Rn02_00334978 predicted 618
3 SASI_Rn02_00334979 predicted 736
4 SASI_Rn02_00334980 predicted 2162
5 SASI_Rn02_00334981 predicted 2876
6 SASI_Rn02_00334982 predicted 1487
7 SASI_Rn02_00334983 predicted 1880
8 SASI_Rn02_00334984 predicted 768
9 SASI_Rn02_00334985 predicted 2237
10 SASI_Rn02_00334986 predicted 4082
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388559 predicted 3433
2 SASI_Rn02_00388560 predicted 3860
3 SASI_Rn02_00388561 predicted 618
4 SASI_Rn02_00388562 predicted 742
5 SASI_Rn02_00388563 predicted 1492
6 SASI_Rn02_00388564 predicted 1876
7 SASI_Rn02_00388565 predicted 767
8 SASI_Rn02_00388566 predicted 4081
9 SASI_Rn02_00388567 predicted 3718
10 SASI_Rn02_00388568 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294751 predicted 3497
2 SASI_Mm02_00294752 predicted 529
3 SASI_Mm02_00294753 predicted 276
4 SASI_Mm02_00294754 predicted 794
5 SASI_Mm02_00294755 predicted 1544
6 SASI_Mm02_00294756 predicted 3178
7 SASI_Mm02_00294757 predicted 1144
8 SASI_Mm02_00294758 predicted 1714
9 SASI_Mm02_00294759 predicted 3518
10 SASI_Mm02_00294760 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259708 predicted 3461
2 SASI_Mm01_00259709 predicted 489
3 SASI_Mm01_00259710 predicted 235
4 SASI_Mm01_00259711 predicted 754
5 SASI_Mm01_00259712 predicted 1494
6 SASI_Mm01_00259713 predicted 1103
7 SASI_Mm01_00259714 predicted 1679
8 SASI_Mm01_00259715 predicted 3477
9 SASI_Mm01_00259716 predicted 777
10 SASI_Mm01_00259717 predicted 2210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223738 predicted 3458
2 SASI_Mm01_00223739 predicted 488
3 SASI_Mm01_00223740 predicted 224
4 SASI_Mm01_00223741 predicted 744
5 SASI_Mm01_00223742 predicted 1490
6 SASI_Mm01_00223743 predicted 1096
7 SASI_Mm01_00223744 predicted 1666
8 SASI_Mm01_00223745 predicted 3478
9 SASI_Mm01_00223746 predicted 772
10 SASI_Mm01_00223747 predicted 2213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081057
VALIDATED
TECPR2 MISSION shRNA Bacterial Glycerol Stock
tectonin beta-propeller repeat containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081057.2-859s21c1
Sequence:CCGGGTGTAAGCAAAGCGATCTAACCTCGAGGTTAGATCGCTTTGCTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081057.2-3297s21c1
Sequence:CCGGAGGTGAGCATCACGGACTATGCTCGAGCATAGTCCGTGATGCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081057.2-4869s21c1
Sequence:CCGGGCTTGCAGCTACTGGATATATCTCGAGATATATCCAGTAGCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081057.2-931s21c1
Sequence:CCGGGACCGTTCAAGCCACATATATCTCGAGATATATGTGGCTTGAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081057.2-525s21c1
Sequence:CCGGACAAGCAGCTGCGGAGATTTGCTCGAGCAAATCTCCGCAGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081057
VALIDATED
TECPR2 MISSION shRNA shRNA Plasmid DNA
tectonin beta-propeller repeat containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081057.2-859s21c1
Sequence:CCGGGTGTAAGCAAAGCGATCTAACCTCGAGGTTAGATCGCTTTGCTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081057.2-3297s21c1
Sequence:CCGGAGGTGAGCATCACGGACTATGCTCGAGCATAGTCCGTGATGCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081057.2-4869s21c1
Sequence:CCGGGCTTGCAGCTACTGGATATATCTCGAGATATATCCAGTAGCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081057.2-931s21c1
Sequence:CCGGGACCGTTCAAGCCACATATATCTCGAGATATATGTGGCTTGAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081057.2-525s21c1
Sequence:CCGGACAAGCAGCTGCGGAGATTTGCTCGAGCAAATCTCCGCAGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081057
VALIDATED
TECPR2 MISSION shRNA Lentiviral Transduction Particles
tectonin beta-propeller repeat containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081057.2-859s21c1
Sequence:CCGGGTGTAAGCAAAGCGATCTAACCTCGAGGTTAGATCGCTTTGCTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081057.2-3297s21c1
Sequence:CCGGAGGTGAGCATCACGGACTATGCTCGAGCATAGTCCGTGATGCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081057.2-4869s21c1
Sequence:CCGGGCTTGCAGCTACTGGATATATCTCGAGATATATCCAGTAGCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081057.2-931s21c1
Sequence:CCGGGACCGTTCAAGCCACATATATCTCGAGATATATGTGGCTTGAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081057.2-525s21c1
Sequence:CCGGACAAGCAGCTGCGGAGATTTGCTCGAGCAAATCTCCGCAGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014844
TECPR2 MISSION shRNA Bacterial Glycerol Stock
tectonin beta-propeller repeat containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014844.2-3249s21c1
Sequence:CCGGTTGACCAGTGCAGCTTATTTCCTCGAGGAAATAAGCTGCACTGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014844.2-5422s21c1
Sequence:CCGGGAGGACGAGTCTACTAATTATCTCGAGATAATTAGTAGACTCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014844.2-1686s21c1
Sequence:CCGGGCAGTAGCGTGGATCAGTTAACTCGAGTTAACTGATCCACGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014844.2-669s21c1
Sequence:CCGGCCATTGTGCAGCTGGATTATACTCGAGTATAATCCAGCTGCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167788    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014844.2-5444s1c1
Sequence:CCGGGCCTTTGTTGTTGTATTACAACTCGAGTTGTAATACAACAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014844
TECPR2 MISSION shRNA shRNA Plasmid DNA
tectonin beta-propeller repeat containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014844.2-3249s21c1
Sequence:CCGGTTGACCAGTGCAGCTTATTTCCTCGAGGAAATAAGCTGCACTGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014844.2-5422s21c1
Sequence:CCGGGAGGACGAGTCTACTAATTATCTCGAGATAATTAGTAGACTCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014844.2-1686s21c1
Sequence:CCGGGCAGTAGCGTGGATCAGTTAACTCGAGTTAACTGATCCACGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014844.2-669s21c1
Sequence:CCGGCCATTGTGCAGCTGGATTATACTCGAGTATAATCCAGCTGCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167788    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014844.2-5444s1c1
Sequence:CCGGGCCTTTGTTGTTGTATTACAACTCGAGTTGTAATACAACAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014844
TECPR2 MISSION shRNA Lentiviral Transduction Particles
tectonin beta-propeller repeat containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014844.2-3249s21c1
Sequence:CCGGTTGACCAGTGCAGCTTATTTCCTCGAGGAAATAAGCTGCACTGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014844.2-5422s21c1
Sequence:CCGGGAGGACGAGTCTACTAATTATCTCGAGATAATTAGTAGACTCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014844.2-1686s21c1
Sequence:CCGGGCAGTAGCGTGGATCAGTTAACTCGAGTTAACTGATCCACGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014844.2-669s21c1
Sequence:CCGGCCATTGTGCAGCTGGATTATACTCGAGTATAATCCAGCTGCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167788    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014844.2-5444s1c1
Sequence:CCGGGCCTTTGTTGTTGTATTACAACTCGAGTTGTAATACAACAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks