EMAIL THIS PAGE TO A FRIEND

TECR

trans-2,3-enoyl-CoA reductase

Synonyms: GPSN2 MRT14 SC2 TER
UniProtKB ID: Q9NZ01, B2RD55, O75350, Q6IBB2, Q9BWK3, Q9Y6P0
Gene ID:
Human(9524) Summary: This gene encodes a multi-pass membrane protein that resides in the endoplasmic reticulum, and belongs to the steroid 5-alpha reductase family. The elongation of microsomal long and very long chain fatty acid consists of 4 sequential reactions. This protein catalyzes the final step, reducing trans-2,3-enoyl-CoA to saturated acyl-CoA. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Apr 2011]
Mouse(106529) trans-2,3-enoyl-CoA reductase
Rat(191576) trans-2,3-enoyl-CoA reductase
domestic guinea pig(100714067) trans-2,3-enoyl-CoA reductase
naked mole-rat(101716060) trans-2,3-enoyl-CoA reductase
cow(614105) trans-2,3-enoyl-CoA reductase
sheep(101117331) trans-2,3-enoyl-CoA reductase
chicken(424491) trans-2,3-enoyl-CoA reductase
dog(476687) trans-2,3-enoyl-CoA reductase
domestic cat(101091601) trans-2,3-enoyl-CoA reductase
Horse(100065024) trans-2,3-enoyl-CoA reductase
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138501 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138501 Rosetta Predictions human pricing
NM_138549 Rosetta Predictions rat pricing
NM_134118 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014323 predicted 204
2 SASI_Hs01_00014324 predicted 201
3 SASI_Hs01_00014325 predicted 639
4 SASI_Hs01_00014326 predicted 716
5 SASI_Hs01_00014327 predicted 450
6 SASI_Hs01_00014328 predicted 585
7 SASI_Hs01_00014329 predicted 739
8 SASI_Hs01_00014330 predicted 521
9 SASI_Hs01_00014331 predicted 595
10 SASI_Hs02_00363694 predicted 582
11 SASI_Hs01_00014332 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056449 predicted 504
2 SASI_Rn02_00268190 predicted 151
3 SASI_Rn01_00056444 predicted 406
4 SASI_Rn01_00056445 predicted 586
5 SASI_Rn01_00056446 predicted 538
6 SASI_Rn01_00056447 predicted 570
7 SASI_Rn01_00056448 predicted 465
8 SASI_Rn01_00056450 predicted 216
9 SASI_Rn01_00056451 predicted 478
10 SASI_Rn01_00056452 predicted 870
11 SASI_Rn01_00056453 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062725 predicted 562
2 SASI_Mm01_00062727 predicted 618
3 SASI_Mm01_00062728 predicted 667
4 SASI_Mm01_00062729 predicted 580
5 SASI_Mm01_00062731 predicted 432
6 SASI_Mm02_00339365 predicted 564
7 SASI_Mm01_00062732 predicted 224
8 SASI_Mm01_00062733 predicted 548
9 SASI_Mm02_00339366 predicted 673
10 SASI_Mm02_00339367 predicted 620
11 SASI_Mm01_00062726 predicted 382
12 SASI_Mm01_00062730 predicted 869
13 SASI_Mm01_00062734 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138501
VALIDATED
TECR MISSION shRNA Bacterial Glycerol Stock
trans-2,3-enoyl-CoA reductase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-677s1c1
Sequence:CCGGCATCTTTGTGATCTGCCAGCTCTCGAGAGCTGGCAGATCACAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-173s1c1
Sequence:CCGGGATCAAGAACCTCTTCACTAACTCGAGTTAGTGAAGAGGTTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-416s1c1
Sequence:CCGGCTATGGCCACAAATATGACTTCTCGAGAAGTCATATTTGTGGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138501.3-125s1c1
Sequence:CCGGGAAGCTGTGTTTCTTGGACAACTCGAGTTGTCCAAGAAACACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138501.3-554s1c1
Sequence:CCGGGCGCAACATCTTCAAGAACTGCTCGAGCAGTTCTTGAAGATGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-131s1c1
Sequence:CCGGGTGTTTCTTGGACAAGGTGGACTCGAGTCCACCTTGTCCAAGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138501.3-179s1c1
Sequence:CCGGGAACCTCTTCACTAAGACCCACTCGAGTGGGTCTTAGTGAAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-254s1c1
Sequence:CCGGCCTGAAGGATGAGGATGTTCTCTCGAGAGAACATCCTCATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-178s21c1
Sequence:CCGGGTGTTTCTTGGACAAGGTGGACTCGAGTCCACCTTGTCCAAGAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-724s21c1
Sequence:CCGGCATCTTTGTGATCTGCCAGCTCTCGAGAGCTGGCAGATCACAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-463s21c1
Sequence:CCGGCTATGGCCACAAATATGACTTCTCGAGAAGTCATATTTGTGGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-301s21c1
Sequence:CCGGCCTGAAGGATGAGGATGTTCTCTCGAGAGAACATCCTCATCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-220s21c1
Sequence:CCGGGATCAAGAACCTCTTCACTAACTCGAGTTAGTGAAGAGGTTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138501
VALIDATED
TECR MISSION shRNA shRNA Plasmid DNA
trans-2,3-enoyl-CoA reductase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-677s1c1
Sequence:CCGGCATCTTTGTGATCTGCCAGCTCTCGAGAGCTGGCAGATCACAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-173s1c1
Sequence:CCGGGATCAAGAACCTCTTCACTAACTCGAGTTAGTGAAGAGGTTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-416s1c1
Sequence:CCGGCTATGGCCACAAATATGACTTCTCGAGAAGTCATATTTGTGGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138501.3-125s1c1
Sequence:CCGGGAAGCTGTGTTTCTTGGACAACTCGAGTTGTCCAAGAAACACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138501.3-554s1c1
Sequence:CCGGGCGCAACATCTTCAAGAACTGCTCGAGCAGTTCTTGAAGATGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-131s1c1
Sequence:CCGGGTGTTTCTTGGACAAGGTGGACTCGAGTCCACCTTGTCCAAGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138501.3-179s1c1
Sequence:CCGGGAACCTCTTCACTAAGACCCACTCGAGTGGGTCTTAGTGAAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-254s1c1
Sequence:CCGGCCTGAAGGATGAGGATGTTCTCTCGAGAGAACATCCTCATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-178s21c1
Sequence:CCGGGTGTTTCTTGGACAAGGTGGACTCGAGTCCACCTTGTCCAAGAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-724s21c1
Sequence:CCGGCATCTTTGTGATCTGCCAGCTCTCGAGAGCTGGCAGATCACAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-463s21c1
Sequence:CCGGCTATGGCCACAAATATGACTTCTCGAGAAGTCATATTTGTGGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-301s21c1
Sequence:CCGGCCTGAAGGATGAGGATGTTCTCTCGAGAGAACATCCTCATCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-220s21c1
Sequence:CCGGGATCAAGAACCTCTTCACTAACTCGAGTTAGTGAAGAGGTTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138501
VALIDATED
TECR MISSION shRNA Lentiviral Transduction Particles
trans-2,3-enoyl-CoA reductase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-677s1c1
Sequence:CCGGCATCTTTGTGATCTGCCAGCTCTCGAGAGCTGGCAGATCACAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-173s1c1
Sequence:CCGGGATCAAGAACCTCTTCACTAACTCGAGTTAGTGAAGAGGTTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-416s1c1
Sequence:CCGGCTATGGCCACAAATATGACTTCTCGAGAAGTCATATTTGTGGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138501.3-125s1c1
Sequence:CCGGGAAGCTGTGTTTCTTGGACAACTCGAGTTGTCCAAGAAACACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138501.3-554s1c1
Sequence:CCGGGCGCAACATCTTCAAGAACTGCTCGAGCAGTTCTTGAAGATGTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-131s1c1
Sequence:CCGGGTGTTTCTTGGACAAGGTGGACTCGAGTCCACCTTGTCCAAGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138501.3-179s1c1
Sequence:CCGGGAACCTCTTCACTAAGACCCACTCGAGTGGGTCTTAGTGAAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138501.3-254s1c1
Sequence:CCGGCCTGAAGGATGAGGATGTTCTCTCGAGAGAACATCCTCATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-178s21c1
Sequence:CCGGGTGTTTCTTGGACAAGGTGGACTCGAGTCCACCTTGTCCAAGAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-724s21c1
Sequence:CCGGCATCTTTGTGATCTGCCAGCTCTCGAGAGCTGGCAGATCACAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-463s21c1
Sequence:CCGGCTATGGCCACAAATATGACTTCTCGAGAAGTCATATTTGTGGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-301s21c1
Sequence:CCGGCCTGAAGGATGAGGATGTTCTCTCGAGAGAACATCCTCATCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138501.4-220s21c1
Sequence:CCGGGATCAAGAACCTCTTCACTAACTCGAGTTAGTGAAGAGGTTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134118
VALIDATED
TECR MISSION shRNA Bacterial Glycerol Stock
trans-2,3-enoyl-CoA reductase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134118.1-633s1c1
Sequence:CCGGGATGGCTTATTACATCAACCACTCGAGTGGTTGATGTAATAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134118.1-286s1c1
Sequence:CCGGCTGAAAGATGAAGATGTCTTACTCGAGTAAGACATCTTCATCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134118.1-191s1c1
Sequence:CCGGCCACCATTTCTGAAATCAAGACTCGAGTCTTGATTTCAGAAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134118.1-285s1c1
Sequence:CCGGCCTGAAAGATGAAGATGTCTTCTCGAGAAGACATCTTCATCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134118.1-580s1c1
Sequence:CCGGCCTTTGCGAAACATCTTCAAACTCGAGTTTGAAGATGTTTCGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134118.5-475s21c1
Sequence:CCGGATGGCCGCAAATACGACTTTACTCGAGTAAAGTCGTATTTGCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134118.4-441s1c1
Sequence:CCGGCTTCATTTATGGCCGCAAATACTCGAGTATTTGCGGCCATAAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134118.5-466s21c1
Sequence:CCGGCCTTCATTTATGGCCGCAAATCTCGAGATTTGCGGCCATAAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134118.5-312s21c1
Sequence:CCGGCTGAAAGATGAAGATGTCTTACTCGAGTAAGACATCTTCATCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134118.5-217s21c1
Sequence:CCGGCCACCATTTCTGAAATCAAGACTCGAGTCTTGATTTCAGAAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134118
VALIDATED
TECR MISSION shRNA shRNA Plasmid DNA
trans-2,3-enoyl-CoA reductase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134118.1-633s1c1
Sequence:CCGGGATGGCTTATTACATCAACCACTCGAGTGGTTGATGTAATAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134118.1-286s1c1
Sequence:CCGGCTGAAAGATGAAGATGTCTTACTCGAGTAAGACATCTTCATCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134118.1-191s1c1
Sequence:CCGGCCACCATTTCTGAAATCAAGACTCGAGTCTTGATTTCAGAAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134118.1-285s1c1
Sequence:CCGGCCTGAAAGATGAAGATGTCTTCTCGAGAAGACATCTTCATCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134118.1-580s1c1
Sequence:CCGGCCTTTGCGAAACATCTTCAAACTCGAGTTTGAAGATGTTTCGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134118.5-475s21c1
Sequence:CCGGATGGCCGCAAATACGACTTTACTCGAGTAAAGTCGTATTTGCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134118.4-441s1c1
Sequence:CCGGCTTCATTTATGGCCGCAAATACTCGAGTATTTGCGGCCATAAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134118.5-466s21c1
Sequence:CCGGCCTTCATTTATGGCCGCAAATCTCGAGATTTGCGGCCATAAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134118.5-312s21c1
Sequence:CCGGCTGAAAGATGAAGATGTCTTACTCGAGTAAGACATCTTCATCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134118.5-217s21c1
Sequence:CCGGCCACCATTTCTGAAATCAAGACTCGAGTCTTGATTTCAGAAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134118
VALIDATED
TECR MISSION shRNA Lentiviral Transduction Particles
trans-2,3-enoyl-CoA reductase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134118.1-633s1c1
Sequence:CCGGGATGGCTTATTACATCAACCACTCGAGTGGTTGATGTAATAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134118.1-286s1c1
Sequence:CCGGCTGAAAGATGAAGATGTCTTACTCGAGTAAGACATCTTCATCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134118.1-191s1c1
Sequence:CCGGCCACCATTTCTGAAATCAAGACTCGAGTCTTGATTTCAGAAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134118.1-285s1c1
Sequence:CCGGCCTGAAAGATGAAGATGTCTTCTCGAGAAGACATCTTCATCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134118.1-580s1c1
Sequence:CCGGCCTTTGCGAAACATCTTCAAACTCGAGTTTGAAGATGTTTCGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134118.5-475s21c1
Sequence:CCGGATGGCCGCAAATACGACTTTACTCGAGTAAAGTCGTATTTGCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134118.4-441s1c1
Sequence:CCGGCTTCATTTATGGCCGCAAATACTCGAGTATTTGCGGCCATAAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134118.5-466s21c1
Sequence:CCGGCCTTCATTTATGGCCGCAAATCTCGAGATTTGCGGCCATAAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134118.5-312s21c1
Sequence:CCGGCTGAAAGATGAAGATGTCTTACTCGAGTAAGACATCTTCATCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134118.5-217s21c1
Sequence:CCGGCCACCATTTCTGAAATCAAGACTCGAGTCTTGATTTCAGAAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks