EMAIL THIS PAGE TO A FRIEND

TECRL

trans-2,3-enoyl-CoA reductase-like

Synonyms: GPSN2L SRD5A2L2 TERL
UniProtKB ID: Q5HYJ1
Gene ID:
Mouse(243078) trans-2,3-enoyl-CoA reductase-like
Rat(364134) trans-2,3-enoyl-CoA reductase-like
chicken(422618) trans-2,3-enoyl-CoA reductase-like
Horse(100066162) trans-2,3-enoyl-CoA reductase-like
domestic cat(101080786) trans-2,3-enoyl-CoA reductase-like
dog(475157) trans-2,3-enoyl-CoA reductase-like
cow(616643) trans-2,3-enoyl-CoA reductase-like
sheep(101114272) trans-2,3-enoyl-CoA reductase-like
naked mole-rat(101710440) trans-2,3-enoyl-CoA reductase-like
domestic guinea pig(100725545) trans-2,3-enoyl-CoA reductase-like
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0128 AQUA Peptide YLLETLFVH[K] cow, dog, human pricing
AQ0127 AQUA Peptide LVLSAGPLRPTPAV[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010874 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010874 Rosetta Predictions human pricing
NM_001108860 Rosetta Predictions rat pricing
NM_153801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167932 predicted 859
2 SASI_Hs01_00167933 predicted 1172
3 SASI_Hs01_00167934 predicted 1124
4 SASI_Hs01_00167935 predicted 353
5 SASI_Hs01_00167937 predicted 595
6 SASI_Hs01_00167938 predicted 462
7 SASI_Hs01_00167939 predicted 802
8 SASI_Hs01_00167940 predicted 754
9 SASI_Hs01_00167941 predicted 345
10 SASI_Hs02_00305830 predicted 356
11 SASI_Hs01_00167936 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242795 predicted 838
2 SASI_Rn02_00242796 predicted 1116
3 SASI_Rn02_00242797 predicted 971
4 SASI_Rn02_00242798 predicted 330
5 SASI_Rn02_00242799 predicted 1079
6 SASI_Rn02_00242800 predicted 226
7 SASI_Rn02_00242801 predicted 375
8 SASI_Rn02_00242802 predicted 496
9 SASI_Rn02_00242803 predicted 606
10 SASI_Rn02_00242804 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185026 predicted 1267
2 SASI_Mm01_00185027 predicted 488
3 SASI_Mm01_00185028 predicted 835
4 SASI_Mm01_00185029 predicted 268
5 SASI_Mm01_00185030 predicted 970
6 SASI_Mm01_00185031 predicted 1239
7 SASI_Mm01_00185032 predicted 566
8 SASI_Mm02_00343537 predicted 1283
9 SASI_Mm01_00185034 predicted 375
10 SASI_Mm01_00185035 predicted 322
11 SASI_Mm01_00185033 predicted 1080
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010874
TECRL MISSION shRNA Bacterial Glycerol Stock
trans-2,3-enoyl-CoA reductase-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164455    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010874.2-1731s1c1
Sequence:CCGGCCTAACACTTTGACAGGCCAACTCGAGTTGGCCTGTCAAAGTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010874.2-469s1c1
Sequence:CCGGCCATTCAAAGTATTGCAGCTTCTCGAGAAGCTGCAATACTTTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010874.2-1028s1c1
Sequence:CCGGGATTGGATCATGGATTAGTTTCTCGAGAAACTAATCCATGATCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010874.2-1094s1c1
Sequence:CCGGGATGAGTATCCAGATGTCTTTCTCGAGAAAGACATCTGGATACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010874.2-735s1c1
Sequence:CCGGGCAGGACACACACCTTTGAAACTCGAGTTTCAAAGGTGTGTGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010874
TECRL MISSION shRNA shRNA Plasmid DNA
trans-2,3-enoyl-CoA reductase-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164455    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010874.2-1731s1c1
Sequence:CCGGCCTAACACTTTGACAGGCCAACTCGAGTTGGCCTGTCAAAGTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010874.2-469s1c1
Sequence:CCGGCCATTCAAAGTATTGCAGCTTCTCGAGAAGCTGCAATACTTTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010874.2-1028s1c1
Sequence:CCGGGATTGGATCATGGATTAGTTTCTCGAGAAACTAATCCATGATCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010874.2-1094s1c1
Sequence:CCGGGATGAGTATCCAGATGTCTTTCTCGAGAAAGACATCTGGATACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010874.2-735s1c1
Sequence:CCGGGCAGGACACACACCTTTGAAACTCGAGTTTCAAAGGTGTGTGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010874
TECRL MISSION shRNA Lentiviral Transduction Particles
trans-2,3-enoyl-CoA reductase-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164455    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010874.2-1731s1c1
Sequence:CCGGCCTAACACTTTGACAGGCCAACTCGAGTTGGCCTGTCAAAGTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010874.2-469s1c1
Sequence:CCGGCCATTCAAAGTATTGCAGCTTCTCGAGAAGCTGCAATACTTTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010874.2-1028s1c1
Sequence:CCGGGATTGGATCATGGATTAGTTTCTCGAGAAACTAATCCATGATCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010874.2-1094s1c1
Sequence:CCGGGATGAGTATCCAGATGTCTTTCTCGAGAAAGACATCTGGATACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010874.2-735s1c1
Sequence:CCGGGCAGGACACACACCTTTGAAACTCGAGTTTCAAAGGTGTGTGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153801
TECRL MISSION shRNA Bacterial Glycerol Stock
trans-2,3-enoyl-CoA reductase-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-1223s1c1
Sequence:CCGGCGGAAGAAGTTCAACTCATATCTCGAGATATGAGTTGAACTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-650s1c1
Sequence:CCGGCCTCTGTTAATATACCTTCTTCTCGAGAAGAAGGTATATTAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-934s1c1
Sequence:CCGGGCAAGTAATAGTGTCTGCTATCTCGAGATAGCAGACACTATTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-360s1c1
Sequence:CCGGCGACTCACTTTGAGATCGAAACTCGAGTTTCGATCTCAAAGTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-526s1c1
Sequence:CCGGCCCATATTTGAGGGACTACATCTCGAGATGTAGTCCCTCAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153801
TECRL MISSION shRNA shRNA Plasmid DNA
trans-2,3-enoyl-CoA reductase-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-1223s1c1
Sequence:CCGGCGGAAGAAGTTCAACTCATATCTCGAGATATGAGTTGAACTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-650s1c1
Sequence:CCGGCCTCTGTTAATATACCTTCTTCTCGAGAAGAAGGTATATTAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-934s1c1
Sequence:CCGGGCAAGTAATAGTGTCTGCTATCTCGAGATAGCAGACACTATTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-360s1c1
Sequence:CCGGCGACTCACTTTGAGATCGAAACTCGAGTTTCGATCTCAAAGTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-526s1c1
Sequence:CCGGCCCATATTTGAGGGACTACATCTCGAGATGTAGTCCCTCAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153801
TECRL MISSION shRNA Lentiviral Transduction Particles
trans-2,3-enoyl-CoA reductase-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-1223s1c1
Sequence:CCGGCGGAAGAAGTTCAACTCATATCTCGAGATATGAGTTGAACTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-650s1c1
Sequence:CCGGCCTCTGTTAATATACCTTCTTCTCGAGAAGAAGGTATATTAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-934s1c1
Sequence:CCGGGCAAGTAATAGTGTCTGCTATCTCGAGATAGCAGACACTATTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-360s1c1
Sequence:CCGGCGACTCACTTTGAGATCGAAACTCGAGTTTCGATCTCAAAGTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153801.1-526s1c1
Sequence:CCGGCCCATATTTGAGGGACTACATCTCGAGATGTAGTCCCTCAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks