EMAIL THIS PAGE TO A FRIEND

TECTA

tectorin alpha

Synonyms: DFNA12 DFNA8 DFNB21
UniProtKB ID: O75443
Gene ID:
Human(7007) Summary: The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
Mouse(21683) tectorin alpha
Rat(300653) tectorin alpha
chicken(395686) tectorin alpha
domestic cat(101099495) tectorin alpha
dog(489357) tectorin alpha
naked mole-rat(101714637) tectorin alpha
cow(533133) tectorin alpha
sheep(101111119) tectorin alpha
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005422 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009347 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009347 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009347 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005422 Rosetta Predictions human pricing
NM_001106814 Rosetta Predictions rat pricing
NM_009347 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244914 predicted 309
2 SASI_Hs02_00339562 predicted 377
3 SASI_Hs01_00244916 predicted 2360
4 SASI_Hs01_00244917 predicted 2469
5 SASI_Hs01_00244918 predicted 725
6 SASI_Hs01_00244920 predicted 4785
7 SASI_Hs02_00339563 predicted 5731
8 SASI_Hs01_00244921 predicted 4695
9 SASI_Hs01_00244923 predicted 5554
10 SASI_Hs02_00339564 predicted 4569
11 SASI_Hs01_00244915 predicted 1187
12 SASI_Hs01_00244919 predicted 5578
13 SASI_Hs01_00244922 predicted 5924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222668 predicted 444
2 SASI_Rn02_00222669 predicted 6125
3 SASI_Rn02_00222670 predicted 5119
4 SASI_Rn02_00222671 predicted 5695
5 SASI_Rn02_00222672 predicted 1613
6 SASI_Rn02_00222673 predicted 4619
7 SASI_Rn02_00222674 predicted 5215
8 SASI_Rn02_00222675 predicted 3682
9 SASI_Rn02_00222676 predicted 4209
10 SASI_Rn02_00222677 predicted 1588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194689 predicted 4950
2 SASI_Mm02_00315928 predicted 5638
3 SASI_Mm01_00194690 predicted 6706
4 SASI_Mm01_00194691 predicted 1449
5 SASI_Mm02_00315929 predicted 4450
6 SASI_Mm01_00194692 predicted 5529
7 SASI_Mm01_00194693 predicted 4249
8 SASI_Mm01_00194694 predicted 3772
9 SASI_Mm01_00194695 predicted 5049
10 SASI_Mm01_00194697 predicted 1427
11 SASI_Mm01_00194696 predicted 5958
12 SASI_Mm01_00194698 predicted 5702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005422
TECTA MISSION shRNA Bacterial Glycerol Stock
tectorin alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-1271s1c1
Sequence:CCGGGCATATCTACTGCCGTGGAAACTCGAGTTTCCACGGCAGTAGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-5668s1c1
Sequence:CCGGCGCACGATCAATGTGGAATTTCTCGAGAAATTCCACATTGATCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-4629s1c1
Sequence:CCGGGCCCGTCTACTTCTACATTAACTCGAGTTAATGTAGAAGTAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-186s1c1
Sequence:CCGGCCGCACTGTCTATGTCAATAACTCGAGTTATTGACATAGACAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-5667s1c1
Sequence:CCGGCCGCACGATCAATGTGGAATTCTCGAGAATTCCACATTGATCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005422.2-2478s21c1
Sequence:CCGGGTACTCAGACATAGGTCTATTCTCGAGAATAGACCTATGTCTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005422.2-5964s21c1
Sequence:CCGGCAATGATAAGCTCCGATATTTCTCGAGAAATATCGGAGCTTATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005422.2-4799s21c1
Sequence:CCGGACAATGGTTTCAACGTCATTACTCGAGTAATGACGTTGAAACCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005422
TECTA MISSION shRNA shRNA Plasmid DNA
tectorin alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-1271s1c1
Sequence:CCGGGCATATCTACTGCCGTGGAAACTCGAGTTTCCACGGCAGTAGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-5668s1c1
Sequence:CCGGCGCACGATCAATGTGGAATTTCTCGAGAAATTCCACATTGATCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-4629s1c1
Sequence:CCGGGCCCGTCTACTTCTACATTAACTCGAGTTAATGTAGAAGTAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-186s1c1
Sequence:CCGGCCGCACTGTCTATGTCAATAACTCGAGTTATTGACATAGACAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-5667s1c1
Sequence:CCGGCCGCACGATCAATGTGGAATTCTCGAGAATTCCACATTGATCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005422.2-2478s21c1
Sequence:CCGGGTACTCAGACATAGGTCTATTCTCGAGAATAGACCTATGTCTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005422.2-5964s21c1
Sequence:CCGGCAATGATAAGCTCCGATATTTCTCGAGAAATATCGGAGCTTATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005422.2-4799s21c1
Sequence:CCGGACAATGGTTTCAACGTCATTACTCGAGTAATGACGTTGAAACCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005422
TECTA MISSION shRNA Lentiviral Transduction Particles
tectorin alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-1271s1c1
Sequence:CCGGGCATATCTACTGCCGTGGAAACTCGAGTTTCCACGGCAGTAGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-5668s1c1
Sequence:CCGGCGCACGATCAATGTGGAATTTCTCGAGAAATTCCACATTGATCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-4629s1c1
Sequence:CCGGGCCCGTCTACTTCTACATTAACTCGAGTTAATGTAGAAGTAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-186s1c1
Sequence:CCGGCCGCACTGTCTATGTCAATAACTCGAGTTATTGACATAGACAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005422.1-5667s1c1
Sequence:CCGGCCGCACGATCAATGTGGAATTCTCGAGAATTCCACATTGATCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005422.2-2478s21c1
Sequence:CCGGGTACTCAGACATAGGTCTATTCTCGAGAATAGACCTATGTCTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005422.2-5964s21c1
Sequence:CCGGCAATGATAAGCTCCGATATTTCTCGAGAAATATCGGAGCTTATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005422.2-4799s21c1
Sequence:CCGGACAATGGTTTCAACGTCATTACTCGAGTAATGACGTTGAAACCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009347
TECTA MISSION shRNA Bacterial Glycerol Stock
tectorin alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009347.1-7057s1c1
Sequence:CCGGCGTGGTTATAGGCAAGGCTATCTCGAGATAGCCTTGCCTATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009347.1-4045s1c1
Sequence:CCGGGCACTGAGTATCAACGAGTTTCTCGAGAAACTCGTTGATACTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009347.1-1427s1c1
Sequence:CCGGGCTACAAGATTCTCATTCCTACTCGAGTAGGAATGAGAATCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009347.1-453s1c1
Sequence:CCGGCCGCACCGTCTATGTCAATAACTCGAGTTATTGACATAGACGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009347.1-4942s1c1
Sequence:CCGGCGGAACACTGTCAAGGTGAATCTCGAGATTCACCTTGACAGTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009347
TECTA MISSION shRNA shRNA Plasmid DNA
tectorin alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009347.1-7057s1c1
Sequence:CCGGCGTGGTTATAGGCAAGGCTATCTCGAGATAGCCTTGCCTATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009347.1-4045s1c1
Sequence:CCGGGCACTGAGTATCAACGAGTTTCTCGAGAAACTCGTTGATACTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009347.1-1427s1c1
Sequence:CCGGGCTACAAGATTCTCATTCCTACTCGAGTAGGAATGAGAATCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009347.1-453s1c1
Sequence:CCGGCCGCACCGTCTATGTCAATAACTCGAGTTATTGACATAGACGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009347.1-4942s1c1
Sequence:CCGGCGGAACACTGTCAAGGTGAATCTCGAGATTCACCTTGACAGTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009347
TECTA MISSION shRNA Lentiviral Transduction Particles
tectorin alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009347.1-7057s1c1
Sequence:CCGGCGTGGTTATAGGCAAGGCTATCTCGAGATAGCCTTGCCTATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009347.1-4045s1c1
Sequence:CCGGGCACTGAGTATCAACGAGTTTCTCGAGAAACTCGTTGATACTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009347.1-1427s1c1
Sequence:CCGGGCTACAAGATTCTCATTCCTACTCGAGTAGGAATGAGAATCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009347.1-453s1c1
Sequence:CCGGCCGCACCGTCTATGTCAATAACTCGAGTTATTGACATAGACGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009347.1-4942s1c1
Sequence:CCGGCGGAACACTGTCAAGGTGAATCTCGAGATTCACCTTGACAGTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks