EMAIL THIS PAGE TO A FRIEND

TECTB

tectorin beta

UniProtKB ID: Q96PL2, Q5VW53
Gene ID:
Human(6975) Summary: The genes for alpha-tectorin (MIM 602574) and beta-tectorin encode the major noncollagenous proteins of the tectorial membrane of the cochlea.[supplied by OMIM, Jul 2002]
Mouse(21684) tectorin beta
Rat(292124) tectorin beta
cow(538466) tectorin beta
sheep(101121222) tectorin beta
Zebrafish(494051) tectorin beta
domestic cat(101094882) tectorin beta
dog(486891) tectorin beta
chicken(396320) tectorin beta
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301566 ANTI-TECTB (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009348 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009348 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009348 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_058222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058222 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053131 MISSION® esiRNA esiRNA human TECTB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058222 Rosetta Predictions human pricing
NM_001106200 Rosetta Predictions rat pricing
NM_009348 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073261 predicted 216
2 SASI_Hs01_00073262 predicted 292
3 SASI_Hs01_00073263 predicted 570
4 SASI_Hs01_00073264 predicted 459
5 SASI_Hs01_00073265 predicted 457
6 SASI_Hs01_00073266 predicted 258
7 SASI_Hs01_00073268 predicted 427
8 SASI_Hs01_00073269 predicted 307
9 SASI_Hs01_00073270 predicted 690
10 SASI_Hs02_00362138 predicted 208
11 SASI_Hs01_00073267 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216618 predicted 695
2 SASI_Rn02_00216619 predicted 663
3 SASI_Rn02_00216620 predicted 706
4 SASI_Rn02_00216621 predicted 963
5 SASI_Rn02_00216622 predicted 195
6 SASI_Rn02_00216623 predicted 715
7 SASI_Rn02_00216624 predicted 694
8 SASI_Rn02_00216625 predicted 709
9 SASI_Rn02_00216626 predicted 683
10 SASI_Rn02_00216627 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009348 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068153 predicted 358
2 SASI_Mm01_00068154 predicted 656
3 SASI_Mm01_00068155 predicted 711
4 SASI_Mm01_00068156 predicted 469
5 SASI_Mm01_00068157 predicted 978
6 SASI_Mm01_00068158 predicted 1066
7 SASI_Mm01_00068159 predicted 666
8 SASI_Mm01_00068160 predicted 201
9 SASI_Mm01_00068161 predicted 923
10 SASI_Mm01_00068162 predicted 688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009348
TECTB MISSION shRNA Bacterial Glycerol Stock
tectorin beta
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009348.3-1166s21c1
Sequence:CCGGACTATGACACATTCGTTTATTCTCGAGAATAAACGAATGTGTCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009348.3-1308s21c1
Sequence:CCGGGAGCCACACTTCCACTTATTCCTCGAGGAATAAGTGGAAGTGTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009348.2-1393s1c1
Sequence:CCGGCGCTCAAATTAGAGCAGCATTCTCGAGAATGCTGCTCTAATTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009348.2-716s1c1
Sequence:CCGGCGGTTCAAAGTGGTCTTGAATCTCGAGATTCAAGACCACTTTGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009348.2-179s1c1
Sequence:CCGGGCGAAATCATGCACTCCGAATCTCGAGATTCGGAGTGCATGATTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009348.2-230s1c1
Sequence:CCGGCCCAAGACCATCATCACTAAACTCGAGTTTAGTGATGATGGTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009348.2-349s1c1
Sequence:CCGGCCCTGATCTGTCACCTAAGAACTCGAGTTCTTAGGTGACAGATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009348
TECTB MISSION shRNA shRNA Plasmid DNA
tectorin beta
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009348.3-1166s21c1
Sequence:CCGGACTATGACACATTCGTTTATTCTCGAGAATAAACGAATGTGTCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009348.3-1308s21c1
Sequence:CCGGGAGCCACACTTCCACTTATTCCTCGAGGAATAAGTGGAAGTGTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009348.2-1393s1c1
Sequence:CCGGCGCTCAAATTAGAGCAGCATTCTCGAGAATGCTGCTCTAATTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009348.2-716s1c1
Sequence:CCGGCGGTTCAAAGTGGTCTTGAATCTCGAGATTCAAGACCACTTTGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009348.2-179s1c1
Sequence:CCGGGCGAAATCATGCACTCCGAATCTCGAGATTCGGAGTGCATGATTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009348.2-230s1c1
Sequence:CCGGCCCAAGACCATCATCACTAAACTCGAGTTTAGTGATGATGGTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009348.2-349s1c1
Sequence:CCGGCCCTGATCTGTCACCTAAGAACTCGAGTTCTTAGGTGACAGATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009348
TECTB MISSION shRNA Lentiviral Transduction Particles
tectorin beta
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009348.3-1166s21c1
Sequence:CCGGACTATGACACATTCGTTTATTCTCGAGAATAAACGAATGTGTCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009348.3-1308s21c1
Sequence:CCGGGAGCCACACTTCCACTTATTCCTCGAGGAATAAGTGGAAGTGTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009348.2-1393s1c1
Sequence:CCGGCGCTCAAATTAGAGCAGCATTCTCGAGAATGCTGCTCTAATTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009348.2-716s1c1
Sequence:CCGGCGGTTCAAAGTGGTCTTGAATCTCGAGATTCAAGACCACTTTGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009348.2-179s1c1
Sequence:CCGGGCGAAATCATGCACTCCGAATCTCGAGATTCGGAGTGCATGATTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009348.2-230s1c1
Sequence:CCGGCCCAAGACCATCATCACTAAACTCGAGTTTAGTGATGATGGTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009348.2-349s1c1
Sequence:CCGGCCCTGATCTGTCACCTAAGAACTCGAGTTCTTAGGTGACAGATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058222
TECTB MISSION shRNA Bacterial Glycerol Stock
tectorin beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058222.1-699s1c1
Sequence:CCGGGCATGAGAATGGGAGAGATCACTCGAGTGATCTCTCCCATTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058222.1-73s1c1
Sequence:CCGGGCAGATGTCATTCTTGTGTTTCTCGAGAAACACAAGAATGACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-193s1c1
Sequence:CCGGGAAGGAGGTTACTACCAATTTCTCGAGAAATTGGTAGTAACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058222.1-780s1c1
Sequence:CCGGGTGGTTACACTGTGAGACGTTCTCGAGAACGTCTCACAGTGTAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-456s1c1
Sequence:CCGGGAGCCAACTGTCTCTCAACTTCTCGAGAAGTTGAGAGACAGTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-261s1c1
Sequence:CCGGGTCTGAGTACAAGCCACCTATCTCGAGATAGGTGGCTTGTACTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-732s1c1
Sequence:CCGGCCAATTCAATGCTTTCCGGTTCTCGAGAACCGGAAAGCATTGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-565s1c1
Sequence:CCGGGAAGCCAAAGGGTTAAGCATTCTCGAGAATGCTTAACCCTTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058222.1-720s1c1
Sequence:CCGGCAGGGCAACCTTCCAATTCAACTCGAGTTGAATTGGAAGGTTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058222
TECTB MISSION shRNA shRNA Plasmid DNA
tectorin beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058222.1-699s1c1
Sequence:CCGGGCATGAGAATGGGAGAGATCACTCGAGTGATCTCTCCCATTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058222.1-73s1c1
Sequence:CCGGGCAGATGTCATTCTTGTGTTTCTCGAGAAACACAAGAATGACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-193s1c1
Sequence:CCGGGAAGGAGGTTACTACCAATTTCTCGAGAAATTGGTAGTAACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058222.1-780s1c1
Sequence:CCGGGTGGTTACACTGTGAGACGTTCTCGAGAACGTCTCACAGTGTAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-456s1c1
Sequence:CCGGGAGCCAACTGTCTCTCAACTTCTCGAGAAGTTGAGAGACAGTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-261s1c1
Sequence:CCGGGTCTGAGTACAAGCCACCTATCTCGAGATAGGTGGCTTGTACTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-732s1c1
Sequence:CCGGCCAATTCAATGCTTTCCGGTTCTCGAGAACCGGAAAGCATTGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-565s1c1
Sequence:CCGGGAAGCCAAAGGGTTAAGCATTCTCGAGAATGCTTAACCCTTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058222.1-720s1c1
Sequence:CCGGCAGGGCAACCTTCCAATTCAACTCGAGTTGAATTGGAAGGTTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058222
TECTB MISSION shRNA Lentiviral Transduction Particles
tectorin beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058222.1-699s1c1
Sequence:CCGGGCATGAGAATGGGAGAGATCACTCGAGTGATCTCTCCCATTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058222.1-73s1c1
Sequence:CCGGGCAGATGTCATTCTTGTGTTTCTCGAGAAACACAAGAATGACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-193s1c1
Sequence:CCGGGAAGGAGGTTACTACCAATTTCTCGAGAAATTGGTAGTAACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058222.1-780s1c1
Sequence:CCGGGTGGTTACACTGTGAGACGTTCTCGAGAACGTCTCACAGTGTAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-456s1c1
Sequence:CCGGGAGCCAACTGTCTCTCAACTTCTCGAGAAGTTGAGAGACAGTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-261s1c1
Sequence:CCGGGTCTGAGTACAAGCCACCTATCTCGAGATAGGTGGCTTGTACTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-732s1c1
Sequence:CCGGCCAATTCAATGCTTTCCGGTTCTCGAGAACCGGAAAGCATTGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058222.1-565s1c1
Sequence:CCGGGAAGCCAAAGGGTTAAGCATTCTCGAGAATGCTTAACCCTTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058222.1-720s1c1
Sequence:CCGGCAGGGCAACCTTCCAATTCAACTCGAGTTGAATTGGAAGGTTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks