EMAIL THIS PAGE TO A FRIEND

TEDDM1

transmembrane epididymal protein 1

Synonyms: EDDM9 Epdd1 HE9 RP1-223H12.2 TMEM45C
UniProtKB ID: Q5T9Z0, Q8IVJ0
Gene ID:
Mouse(240819) transmembrane epididymal protein 1
Rat(664710) transmembrane epididymal protein 1
cow(614467) transmembrane epididymal protein 1
sheep(101121187) transmembrane epididymal protein 1
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172000 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178244 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178244 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178244 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172000 Rosetta Predictions human pricing
NM_001039915 Rosetta Predictions rat pricing
NM_178244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115128 predicted 471
2 SASI_Hs01_00115129 predicted 827
3 SASI_Hs01_00115132 predicted 473
4 SASI_Hs01_00115133 predicted 826
5 SASI_Hs02_00367759 predicted 278
6 SASI_Hs02_00367760 predicted 209
7 SASI_Hs01_00115136 predicted 512
8 SASI_Hs01_00115137 predicted 816
9 SASI_Hs02_00367761 predicted 835
10 SASI_Hs02_00367762 predicted 759
11 SASI_Hs01_00115130 predicted 214
12 SASI_Hs01_00115131 predicted 209
13 SASI_Hs01_00115134 predicted 213
14 SASI_Hs01_00115135 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204888 predicted 709
2 SASI_Rn01_00098393 predicted 207
3 SASI_Rn01_00098394 predicted 894
4 SASI_Rn01_00098395 predicted 234
5 SASI_Rn01_00098396 predicted 549
6 SASI_Rn02_00204889 predicted 565
7 SASI_Rn02_00204890 predicted 978
8 SASI_Rn01_00098398 predicted 665
9 SASI_Rn01_00098399 predicted 401
10 SASI_Rn01_00098400 predicted 718
11 SASI_Rn01_00098397 predicted 374
12 SASI_Rn01_00098401 predicted 694
13 SASI_Rn01_00098402 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025879 predicted 311
2 SASI_Mm01_00025880 predicted 398
3 SASI_Mm01_00025881 predicted 214
4 SASI_Mm01_00025882 predicted 325
5 SASI_Mm01_00025883 predicted 199
6 SASI_Mm01_00025884 predicted 312
7 SASI_Mm01_00025886 predicted 89
8 SASI_Mm01_00025887 predicted 197
9 SASI_Mm02_00348646 predicted 178
10 SASI_Mm02_00348647 predicted 46
11 SASI_Mm01_00025885 predicted 912
12 SASI_Mm01_00025888 predicted 111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172000
TEDDM1 MISSION shRNA Bacterial Glycerol Stock
transmembrane epididymal protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172000.1-1692s1c1
Sequence:CCGGGCTTTCAAGAATTGGCTTCATCTCGAGATGAAGCCAATTCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172000.1-1902s1c1
Sequence:CCGGGCACATGCAATTTAGCAGATACTCGAGTATCTGCTAAATTGCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-647s1c1
Sequence:CCGGGCAGGCAGGCTTTATTCTATACTCGAGTATAGAATAAAGCCTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-171s1c1
Sequence:CCGGCCGAGGAATAAGCAAAGGTGTCTCGAGACACCTTTGCTTATTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-160s1c1
Sequence:CCGGCTTTGTGCTCTCCGAGGAATACTCGAGTATTCCTCGGAGAGCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172000.1-1369s1c1
Sequence:CCGGCGAGGAGAACACTTCTTCTTACTCGAGTAAGAAGAAGTGTTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172000.1-138s1c1
Sequence:CCGGCTCAAAGGTTGTGTCCTGTATCTCGAGATACAGGACACAACCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-761s1c1
Sequence:CCGGCTCATTCCTGTTGGGAATCTACTCGAGTAGATTCCCAACAGGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-767s1c1
Sequence:CCGGCCTGTTGGGAATCTATGGCTTCTCGAGAAGCCATAGATTCCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172000.1-1689s1c1
Sequence:CCGGGCAGCTTTCAAGAATTGGCTTCTCGAGAAGCCAATTCTTGAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-512s1c1
Sequence:CCGGGCACGTTTATTCTCTGCTCATCTCGAGATGAGCAGAGAATAAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172000.1-1550s1c1
Sequence:CCGGCCATTCAATCTCATCTTGATACTCGAGTATCAAGATGAGATTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172000
TEDDM1 MISSION shRNA shRNA Plasmid DNA
transmembrane epididymal protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172000.1-1692s1c1
Sequence:CCGGGCTTTCAAGAATTGGCTTCATCTCGAGATGAAGCCAATTCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172000.1-1902s1c1
Sequence:CCGGGCACATGCAATTTAGCAGATACTCGAGTATCTGCTAAATTGCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-647s1c1
Sequence:CCGGGCAGGCAGGCTTTATTCTATACTCGAGTATAGAATAAAGCCTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-171s1c1
Sequence:CCGGCCGAGGAATAAGCAAAGGTGTCTCGAGACACCTTTGCTTATTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-160s1c1
Sequence:CCGGCTTTGTGCTCTCCGAGGAATACTCGAGTATTCCTCGGAGAGCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172000.1-1369s1c1
Sequence:CCGGCGAGGAGAACACTTCTTCTTACTCGAGTAAGAAGAAGTGTTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172000.1-138s1c1
Sequence:CCGGCTCAAAGGTTGTGTCCTGTATCTCGAGATACAGGACACAACCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-761s1c1
Sequence:CCGGCTCATTCCTGTTGGGAATCTACTCGAGTAGATTCCCAACAGGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-767s1c1
Sequence:CCGGCCTGTTGGGAATCTATGGCTTCTCGAGAAGCCATAGATTCCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172000.1-1689s1c1
Sequence:CCGGGCAGCTTTCAAGAATTGGCTTCTCGAGAAGCCAATTCTTGAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-512s1c1
Sequence:CCGGGCACGTTTATTCTCTGCTCATCTCGAGATGAGCAGAGAATAAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172000.1-1550s1c1
Sequence:CCGGCCATTCAATCTCATCTTGATACTCGAGTATCAAGATGAGATTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172000
TEDDM1 MISSION shRNA Lentiviral Transduction Particles
transmembrane epididymal protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172000.1-1692s1c1
Sequence:CCGGGCTTTCAAGAATTGGCTTCATCTCGAGATGAAGCCAATTCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172000.1-1902s1c1
Sequence:CCGGGCACATGCAATTTAGCAGATACTCGAGTATCTGCTAAATTGCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-647s1c1
Sequence:CCGGGCAGGCAGGCTTTATTCTATACTCGAGTATAGAATAAAGCCTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-171s1c1
Sequence:CCGGCCGAGGAATAAGCAAAGGTGTCTCGAGACACCTTTGCTTATTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-160s1c1
Sequence:CCGGCTTTGTGCTCTCCGAGGAATACTCGAGTATTCCTCGGAGAGCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172000.1-1369s1c1
Sequence:CCGGCGAGGAGAACACTTCTTCTTACTCGAGTAAGAAGAAGTGTTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172000.1-138s1c1
Sequence:CCGGCTCAAAGGTTGTGTCCTGTATCTCGAGATACAGGACACAACCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-761s1c1
Sequence:CCGGCTCATTCCTGTTGGGAATCTACTCGAGTAGATTCCCAACAGGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-767s1c1
Sequence:CCGGCCTGTTGGGAATCTATGGCTTCTCGAGAAGCCATAGATTCCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172000.1-1689s1c1
Sequence:CCGGGCAGCTTTCAAGAATTGGCTTCTCGAGAAGCCAATTCTTGAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172000.1-512s1c1
Sequence:CCGGGCACGTTTATTCTCTGCTCATCTCGAGATGAGCAGAGAATAAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172000.1-1550s1c1
Sequence:CCGGCCATTCAATCTCATCTTGATACTCGAGTATCAAGATGAGATTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178244
TEDDM1 MISSION shRNA Bacterial Glycerol Stock
transmembrane epididymal protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178244.2-82s1c1
Sequence:CCGGGCTGTGATATTCAATGACTCTCTCGAGAGAGTCATTGAATATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178244.2-207s1c1
Sequence:CCGGCGTTTATGAGATCAGTTGTGTCTCGAGACACAACTGATCTCATAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178244.2-329s1c1
Sequence:CCGGGCTGTGTAGAAATGGTGAGCACTCGAGTGCTCACCATTTCTACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178244.2-915s21c1
Sequence:CCGGCTAGAATACCTGGGCATATACCTCGAGGTATATGCCCAGGTATTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178244.2-51s21c1
Sequence:CCGGTGGTCTGTATCAAGCAGTAATCTCGAGATTACTGCTTGATACAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178244.2-193s21c1
Sequence:CCGGGGCTCCCTCTTGATCGTTTATCTCGAGATAAACGATCAAGAGGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178244.2-563s21c1
Sequence:CCGGAGACCTTCCTGATCCTGATAACTCGAGTTATCAGGATCAGGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178244
TEDDM1 MISSION shRNA shRNA Plasmid DNA
transmembrane epididymal protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178244.2-82s1c1
Sequence:CCGGGCTGTGATATTCAATGACTCTCTCGAGAGAGTCATTGAATATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178244.2-207s1c1
Sequence:CCGGCGTTTATGAGATCAGTTGTGTCTCGAGACACAACTGATCTCATAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178244.2-329s1c1
Sequence:CCGGGCTGTGTAGAAATGGTGAGCACTCGAGTGCTCACCATTTCTACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178244.2-915s21c1
Sequence:CCGGCTAGAATACCTGGGCATATACCTCGAGGTATATGCCCAGGTATTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178244.2-51s21c1
Sequence:CCGGTGGTCTGTATCAAGCAGTAATCTCGAGATTACTGCTTGATACAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178244.2-193s21c1
Sequence:CCGGGGCTCCCTCTTGATCGTTTATCTCGAGATAAACGATCAAGAGGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178244.2-563s21c1
Sequence:CCGGAGACCTTCCTGATCCTGATAACTCGAGTTATCAGGATCAGGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178244
TEDDM1 MISSION shRNA Lentiviral Transduction Particles
transmembrane epididymal protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178244.2-82s1c1
Sequence:CCGGGCTGTGATATTCAATGACTCTCTCGAGAGAGTCATTGAATATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178244.2-207s1c1
Sequence:CCGGCGTTTATGAGATCAGTTGTGTCTCGAGACACAACTGATCTCATAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178244.2-329s1c1
Sequence:CCGGGCTGTGTAGAAATGGTGAGCACTCGAGTGCTCACCATTTCTACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178244.2-915s21c1
Sequence:CCGGCTAGAATACCTGGGCATATACCTCGAGGTATATGCCCAGGTATTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178244.2-51s21c1
Sequence:CCGGTGGTCTGTATCAAGCAGTAATCTCGAGATTACTGCTTGATACAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178244.2-193s21c1
Sequence:CCGGGGCTCCCTCTTGATCGTTTATCTCGAGATAAACGATCAAGAGGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178244.2-563s21c1
Sequence:CCGGAGACCTTCCTGATCCTGATAACTCGAGTTATCAGGATCAGGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks