EMAIL THIS PAGE TO A FRIEND

TEF

thyrotrophic embryonic factor

Gene ID:
Human(7008) Summary: This gene encodes a member of the PAR (proline and acidic amino acid-rich) subfamily of basic region/leucine zipper (bZIP) transcription factors. It is expressed in a broad range of cells and tissues in adult animals, however, during embryonic development, TEF expression appears to be restricted to the developing anterior pituitary gland, coincident with the appearance of thyroid-stimulating hormone, beta (TSHB). Indeed, TEF can bind to, and transactivate the TSHB promoter. It shows homology (in the functional domains) with other members of the PAR-bZIP subfamily of transcription factors, which include albumin D box-binding protein (DBP), human hepatic leukemia factor (HLF) and chicken vitellogenin gene-binding protein (VBP); VBP is considered the chicken homologue of TEF. Different members of the subfamily can readily form heterodimers, and share DNA-binding, and transcriptional regulatory properties. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(21685) thyrotroph embryonic factor
Rat(29362) thyrotrophic embryonic factor
chicken(396342) thyrotrophic embryonic factor
dog(607883) thyrotrophic embryonic factor
domestic cat(101100493) thyrotrophic embryonic factor
cow(616076) thyrotrophic embryonic factor
sheep(100192430) thyrotrophic embryonic factor
domestic guinea pig(100715603) thyrotrophic embryonic factor
Domestic Rabbit(100353476) thyrotrophic embryonic factor
naked mole-rat(101708629) thyrotrophic embryonic factor
142 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003216 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003216 Rosetta Predictions human pricing
NM_019194 Rosetta Predictions rat pricing
NM_017376 Rosetta Predictions mouse pricing
NM_153484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137451 predicted 1471
2 SASI_Hs01_00137452 predicted 470
3 SASI_Hs01_00137453 predicted 1128
4 SASI_Hs01_00137454 predicted 344
5 SASI_Hs01_00137455 predicted 1236
6 SASI_Hs01_00137456 predicted 350
7 SASI_Hs01_00137457 predicted 1223
8 SASI_Hs01_00137458 predicted 1254
9 SASI_Hs01_00137459 predicted 1065
10 SASI_Hs01_00137460 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037480 predicted 1384
2 SASI_Rn01_00037481 predicted 1213
3 SASI_Rn02_00262010 predicted 1467
4 SASI_Rn01_00037482 predicted 547
5 SASI_Rn01_00037483 predicted 1353
6 SASI_Rn01_00037484 predicted 970
7 SASI_Rn01_00037485 predicted 1204
8 SASI_Rn01_00037487 predicted 1369
9 SASI_Rn02_00262011 predicted 1357
10 SASI_Rn02_00262012 predicted 1484
11 SASI_Rn01_00037478 predicted 1347
12 SASI_Rn01_00037479 predicted 1469
13 SASI_Rn01_00037486 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163226 predicted 1505
2 SASI_Mm01_00163231 predicted 1398
3 SASI_Mm02_00323863 predicted 1305
4 SASI_Mm01_00163227 predicted 1436
5 SASI_Mm02_00323864 predicted 1375
6 SASI_Mm02_00323865 predicted 998
7 SASI_Mm02_00323866 predicted 1150
8 SASI_Mm02_00323867 predicted 1325
9 SASI_Mm02_00323868 predicted 1231
10 SASI_Mm02_00323869 predicted 1141
11 SASI_Mm01_00163225 predicted 1423
12 SASI_Mm01_00163228 predicted 978
13 SASI_Mm01_00163229 predicted 785
14 SASI_Mm01_00163230 predicted 587
15 SASI_Mm01_00163232 predicted 544
16 SASI_Mm01_00163233 predicted 494
17 SASI_Mm01_00163234 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096494 predicted 1300
2 SASI_Mm01_00096499 predicted 1202
3 SASI_Mm02_00343232 predicted 1104
4 SASI_Mm01_00096495 predicted 1226
5 SASI_Mm02_00343233 predicted 1171
6 SASI_Mm02_00343234 predicted 803
7 SASI_Mm02_00343235 predicted 951
8 SASI_Mm02_00343236 predicted 1130
9 SASI_Mm02_00343237 predicted 1031
10 SASI_Mm02_00343238 predicted 949
11 SASI_Mm01_00096493 predicted 1218
12 SASI_Mm01_00096496 predicted 778
13 SASI_Mm01_00096497 predicted 579
14 SASI_Mm01_00096498 predicted 383
15 SASI_Mm01_00096500 predicted 339
16 SASI_Mm01_00096501 predicted 291
17 SASI_Mm01_00096502 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017376
VALIDATED
TEF MISSION shRNA Bacterial Glycerol Stock
thyrotrophic embryonic factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017376.3-1189s21c1
Sequence:CCGGCTCACGTCTCAGCTTCATTATCTCGAGATAATGAAGCTGAGACGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017376.3-868s21c1
Sequence:CCGGCGTAAGAAGAACAATGTGGCACTCGAGTGCCACATTGTTCTTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017376.3-620s21c1
Sequence:CCGGGCACAGAATCGTCCTTGGAAACTCGAGTTTCCAAGGACGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017376.3-855s21c1
Sequence:CCGGGTATTGGACAAGACGTAAGAACTCGAGTTCTTACGTCTTGTCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017376.3-1278s21c1
Sequence:CCGGATCTACGTAGACGGGTAAATGCTCGAGCATTTACCCGTCTACGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017376.2-2123s1c1
Sequence:CCGGCCGCCGTATATGAGTTGTATTCTCGAGAATACAACTCATATACGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017376.2-832s1c1
Sequence:CCGGCGTAAGAAGAACAATGTGGCACTCGAGTGCCACATTGTTCTTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017376.2-583s1c1
Sequence:CCGGAGCACAGAATCGTCCTTGGAACTCGAGTTCCAAGGACGATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017376.2-819s1c1
Sequence:CCGGGTATTGGACAAGACGTAAGAACTCGAGTTCTTACGTCTTGTCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017376.2-584s1c1
Sequence:CCGGGCACAGAATCGTCCTTGGAAACTCGAGTTTCCAAGGACGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017376
VALIDATED
TEF MISSION shRNA shRNA Plasmid DNA
thyrotrophic embryonic factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017376.3-1189s21c1
Sequence:CCGGCTCACGTCTCAGCTTCATTATCTCGAGATAATGAAGCTGAGACGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017376.3-868s21c1
Sequence:CCGGCGTAAGAAGAACAATGTGGCACTCGAGTGCCACATTGTTCTTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017376.3-620s21c1
Sequence:CCGGGCACAGAATCGTCCTTGGAAACTCGAGTTTCCAAGGACGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017376.3-855s21c1
Sequence:CCGGGTATTGGACAAGACGTAAGAACTCGAGTTCTTACGTCTTGTCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017376.3-1278s21c1
Sequence:CCGGATCTACGTAGACGGGTAAATGCTCGAGCATTTACCCGTCTACGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017376.2-2123s1c1
Sequence:CCGGCCGCCGTATATGAGTTGTATTCTCGAGAATACAACTCATATACGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017376.2-832s1c1
Sequence:CCGGCGTAAGAAGAACAATGTGGCACTCGAGTGCCACATTGTTCTTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017376.2-583s1c1
Sequence:CCGGAGCACAGAATCGTCCTTGGAACTCGAGTTCCAAGGACGATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017376.2-819s1c1
Sequence:CCGGGTATTGGACAAGACGTAAGAACTCGAGTTCTTACGTCTTGTCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017376.2-584s1c1
Sequence:CCGGGCACAGAATCGTCCTTGGAAACTCGAGTTTCCAAGGACGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017376
VALIDATED
TEF MISSION shRNA Lentiviral Transduction Particles
thyrotrophic embryonic factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017376.3-1189s21c1
Sequence:CCGGCTCACGTCTCAGCTTCATTATCTCGAGATAATGAAGCTGAGACGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017376.3-868s21c1
Sequence:CCGGCGTAAGAAGAACAATGTGGCACTCGAGTGCCACATTGTTCTTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017376.3-620s21c1
Sequence:CCGGGCACAGAATCGTCCTTGGAAACTCGAGTTTCCAAGGACGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017376.3-855s21c1
Sequence:CCGGGTATTGGACAAGACGTAAGAACTCGAGTTCTTACGTCTTGTCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017376.3-1278s21c1
Sequence:CCGGATCTACGTAGACGGGTAAATGCTCGAGCATTTACCCGTCTACGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017376.2-2123s1c1
Sequence:CCGGCCGCCGTATATGAGTTGTATTCTCGAGAATACAACTCATATACGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017376.2-832s1c1
Sequence:CCGGCGTAAGAAGAACAATGTGGCACTCGAGTGCCACATTGTTCTTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017376.2-583s1c1
Sequence:CCGGAGCACAGAATCGTCCTTGGAACTCGAGTTCCAAGGACGATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017376.2-819s1c1
Sequence:CCGGGTATTGGACAAGACGTAAGAACTCGAGTTCTTACGTCTTGTCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017376.2-584s1c1
Sequence:CCGGGCACAGAATCGTCCTTGGAAACTCGAGTTTCCAAGGACGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003216
VALIDATED
TEF MISSION shRNA Bacterial Glycerol Stock
thyrotrophic embryonic factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003216.2-791s21c1
Sequence:CCGGGTACTGGACAAGACGCAAGAACTCGAGTTCTTGCGTCTTGTCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003216.2-965s21c1
Sequence:GTACCGGGTCCAAGTATGAGACCAAATACTCGAGTATTTGGTCTCATACTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003216.2-618s21c1
Sequence:GTACCGGGAAGTGGATGTGAACTTCAATCTCGAGATTGAAGTTCACATCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003216.2-4019s21c1
Sequence:CCGGATGACTTCCAGGTGGATATTGCTCGAGCAATATCCACCTGGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003216.2-691s21c1
Sequence:CCGGACCCTCGGAAGCACAAGTTTGCTCGAGCAAACTTGTGCTTCCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003216.2-1890s1c1
Sequence:CCGGCCCTCTTATCTAGGAGGCTTTCTCGAGAAAGCCTCCTAGATAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003216.2-525s1c1
Sequence:CCGGGCCATCTTTCAGCCCTCTGAACTCGAGTTCAGAGGGCTGAAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003216.2-962s1c1
Sequence:CCGGCGTGTCCAAGTATGAGACCAACTCGAGTTGGTCTCATACTTGGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003216.2-343s1c1
Sequence:CCGGCCATCCCATATGATGGCGAATCTCGAGATTCGCCATCATATGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003216
VALIDATED
TEF MISSION shRNA shRNA Plasmid DNA
thyrotrophic embryonic factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003216.2-791s21c1
Sequence:CCGGGTACTGGACAAGACGCAAGAACTCGAGTTCTTGCGTCTTGTCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003216.2-965s21c1
Sequence:GTACCGGGTCCAAGTATGAGACCAAATACTCGAGTATTTGGTCTCATACTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003216.2-618s21c1
Sequence:GTACCGGGAAGTGGATGTGAACTTCAATCTCGAGATTGAAGTTCACATCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003216.2-4019s21c1
Sequence:CCGGATGACTTCCAGGTGGATATTGCTCGAGCAATATCCACCTGGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003216.2-691s21c1
Sequence:CCGGACCCTCGGAAGCACAAGTTTGCTCGAGCAAACTTGTGCTTCCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003216.2-1890s1c1
Sequence:CCGGCCCTCTTATCTAGGAGGCTTTCTCGAGAAAGCCTCCTAGATAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003216.2-525s1c1
Sequence:CCGGGCCATCTTTCAGCCCTCTGAACTCGAGTTCAGAGGGCTGAAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003216.2-962s1c1
Sequence:CCGGCGTGTCCAAGTATGAGACCAACTCGAGTTGGTCTCATACTTGGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003216.2-343s1c1
Sequence:CCGGCCATCCCATATGATGGCGAATCTCGAGATTCGCCATCATATGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003216
VALIDATED
TEF MISSION shRNA Lentiviral Transduction Particles
thyrotrophic embryonic factor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003216.2-791s21c1
Sequence:CCGGGTACTGGACAAGACGCAAGAACTCGAGTTCTTGCGTCTTGTCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003216.2-965s21c1
Sequence:GTACCGGGTCCAAGTATGAGACCAAATACTCGAGTATTTGGTCTCATACTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003216.2-618s21c1
Sequence:GTACCGGGAAGTGGATGTGAACTTCAATCTCGAGATTGAAGTTCACATCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003216.2-4019s21c1
Sequence:CCGGATGACTTCCAGGTGGATATTGCTCGAGCAATATCCACCTGGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003216.2-691s21c1
Sequence:CCGGACCCTCGGAAGCACAAGTTTGCTCGAGCAAACTTGTGCTTCCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003216.2-1890s1c1
Sequence:CCGGCCCTCTTATCTAGGAGGCTTTCTCGAGAAAGCCTCCTAGATAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003216.2-525s1c1
Sequence:CCGGGCCATCTTTCAGCCCTCTGAACTCGAGTTCAGAGGGCTGAAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003216.2-962s1c1
Sequence:CCGGCGTGTCCAAGTATGAGACCAACTCGAGTTGGTCTCATACTTGGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003216.2-343s1c1
Sequence:CCGGCCATCCCATATGATGGCGAATCTCGAGATTCGCCATCATATGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks