EMAIL THIS PAGE TO A FRIEND

TEFM

transcription elongation factor, mitochondrial

Synonyms: C17orf42
UniProtKB ID: Q96QE5, E1P655, Q6GPG5, Q6PJ19, Q96H04, Q9H5Z9
Gene ID:
Mouse(68550) transcription elongation factor, mitochondrial
Rat(287554) transcription elongation factor, mitochondrial
Zebrafish(566236) transcription elongation factor, mitochondrial
domestic cat(101090058) transcription elongation factor, mitochondrial
dog(480615) transcription elongation factor, mitochondrial
naked mole-rat(101720083) transcription elongation factor, mitochondrial
domestic guinea pig(100719417) transcription elongation factor, mitochondrial
sheep(101122199) transcription elongation factor, mitochondrial
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039981 MISSION® esiRNA esiRNA human C17orf42 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024683 Rosetta Predictions human pricing
NM_001025626 Rosetta Predictions rat pricing
XM_001080965 Rosetta Predictions rat pricing
NM_183275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357115 predicted 1091
2 SASI_Hs02_00357116 predicted 558
3 SASI_Hs02_00357117 predicted 695
4 SASI_Hs01_00149280 predicted 662
5 SASI_Hs01_00149282 predicted 389
6 SASI_Hs02_00357118 predicted 733
7 SASI_Hs02_00357119 predicted 704
8 SASI_Hs02_00357120 predicted 1072
9 SASI_Hs01_00149283 predicted 615
10 SASI_Hs01_00149284 predicted 522
11 SASI_Hs01_00149277 predicted 265
12 SASI_Hs01_00149278 predicted 783
13 SASI_Hs01_00149279 predicted 632
14 SASI_Hs01_00149281 predicted 795
15 SASI_Hs01_00149285 predicted 215
16 SASI_Hs01_00149286 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105464 predicted 261
2 SASI_Rn01_00105465 predicted 881
3 SASI_Rn02_00203184 predicted 489
4 SASI_Rn01_00105466 predicted 542
5 SASI_Rn02_00203185 predicted 244
6 SASI_Rn01_00105467 predicted 1026
7 SASI_Rn01_00105468 predicted 514
8 SASI_Rn01_00105469 predicted 522
9 SASI_Rn01_00105470 predicted 679
10 SASI_Rn01_00105472 predicted 504
11 SASI_Rn01_00105463 predicted 244
12 SASI_Rn01_00105471 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370054 predicted 251
2 SASI_Rn02_00370055 predicted 872
3 SASI_Rn02_00370056 predicted 481
4 SASI_Rn02_00370057 predicted 519
5 SASI_Rn02_00370058 predicted 234
6 SASI_Rn02_00370059 predicted 1012
7 SASI_Rn02_00370060 predicted 500
8 SASI_Rn02_00370061 predicted 511
9 SASI_Rn02_00370062 predicted 664
10 SASI_Rn02_00370063 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350367 predicted 270
2 SASI_Mm02_00350368 predicted 329
3 SASI_Mm01_00103814 predicted 891
4 SASI_Mm01_00103815 predicted 808
5 SASI_Mm02_00350369 predicted 537
6 SASI_Mm02_00350370 predicted 319
7 SASI_Mm02_00350371 predicted 763
8 SASI_Mm02_00350372 predicted 346
9 SASI_Mm02_00350373 predicted 757
10 SASI_Mm02_00350374 predicted 990
11 SASI_Mm01_00103811 predicted 992
12 SASI_Mm01_00103812 predicted 823
13 SASI_Mm01_00103813 predicted 829
14 SASI_Mm01_00103816 predicted 905
15 SASI_Mm01_00103817 predicted 958
16 SASI_Mm01_00103818 predicted 983
17 SASI_Mm01_00103819 predicted 968
18 SASI_Mm01_00103820 predicted 974
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024683
VALIDATED
TEFM MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor, mitochondrial
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024683.1-697s1c1
Sequence:CCGGCAGGACTATCCATTCAGAACTCTCGAGAGTTCTGAATGGATAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024683.1-890s1c1
Sequence:CCGGGCTAGTGAAGCAGTTTCTCTTCTCGAGAAGAGAAACTGCTTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024683.1-894s1c1
Sequence:CCGGGTGAAGCAGTTTCTCTTCGATCTCGAGATCGAAGAGAAACTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024683.1-818s1c1
Sequence:CCGGGAGCATGAATCGAAATGCAGTCTCGAGACTGCATTTCGATTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024683.1-912s1c1
Sequence:CCGGGATTCTATACTGAAGGCGGATCTCGAGATCCGCCTTCAGTATAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024683.1-706s1c1
Sequence:CCGGCCATTCAGAACTCATCTCTGTCTCGAGACAGAGATGAGTTCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024683.3-892s21c1
Sequence:CCGGGAGCATGAATCGAAATGCAGTCTCGAGACTGCATTTCGATTCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_024683.3-299s21c1
Sequence:CCGGTTGAATACAGCATCTACTAAACTCGAGTTTAGTAGATGCTGTATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024683.3-1163s21c1
Sequence:CCGGGTTAACGTGCTAAAGTATAATCTCGAGATTATACTTTAGCACGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024683.3-1110s21c1
Sequence:CCGGCTATTGCCTTCTATGAATTAGCTCGAGCTAATTCATAGAAGGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024683.3-968s21c1
Sequence:CCGGGTGAAGCAGTTTCTCTTCGATCTCGAGATCGAAGAGAAACTGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024683
VALIDATED
TEFM MISSION shRNA shRNA Plasmid DNA
transcription elongation factor, mitochondrial
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024683.1-697s1c1
Sequence:CCGGCAGGACTATCCATTCAGAACTCTCGAGAGTTCTGAATGGATAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024683.1-890s1c1
Sequence:CCGGGCTAGTGAAGCAGTTTCTCTTCTCGAGAAGAGAAACTGCTTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024683.1-894s1c1
Sequence:CCGGGTGAAGCAGTTTCTCTTCGATCTCGAGATCGAAGAGAAACTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024683.1-818s1c1
Sequence:CCGGGAGCATGAATCGAAATGCAGTCTCGAGACTGCATTTCGATTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024683.1-912s1c1
Sequence:CCGGGATTCTATACTGAAGGCGGATCTCGAGATCCGCCTTCAGTATAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024683.1-706s1c1
Sequence:CCGGCCATTCAGAACTCATCTCTGTCTCGAGACAGAGATGAGTTCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024683.3-892s21c1
Sequence:CCGGGAGCATGAATCGAAATGCAGTCTCGAGACTGCATTTCGATTCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_024683.3-299s21c1
Sequence:CCGGTTGAATACAGCATCTACTAAACTCGAGTTTAGTAGATGCTGTATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024683.3-1163s21c1
Sequence:CCGGGTTAACGTGCTAAAGTATAATCTCGAGATTATACTTTAGCACGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024683.3-1110s21c1
Sequence:CCGGCTATTGCCTTCTATGAATTAGCTCGAGCTAATTCATAGAAGGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024683.3-968s21c1
Sequence:CCGGGTGAAGCAGTTTCTCTTCGATCTCGAGATCGAAGAGAAACTGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024683
VALIDATED
TEFM MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor, mitochondrial
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024683.1-697s1c1
Sequence:CCGGCAGGACTATCCATTCAGAACTCTCGAGAGTTCTGAATGGATAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024683.1-890s1c1
Sequence:CCGGGCTAGTGAAGCAGTTTCTCTTCTCGAGAAGAGAAACTGCTTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024683.1-894s1c1
Sequence:CCGGGTGAAGCAGTTTCTCTTCGATCTCGAGATCGAAGAGAAACTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024683.1-818s1c1
Sequence:CCGGGAGCATGAATCGAAATGCAGTCTCGAGACTGCATTTCGATTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024683.1-912s1c1
Sequence:CCGGGATTCTATACTGAAGGCGGATCTCGAGATCCGCCTTCAGTATAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024683.1-706s1c1
Sequence:CCGGCCATTCAGAACTCATCTCTGTCTCGAGACAGAGATGAGTTCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024683.3-892s21c1
Sequence:CCGGGAGCATGAATCGAAATGCAGTCTCGAGACTGCATTTCGATTCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_024683.3-299s21c1
Sequence:CCGGTTGAATACAGCATCTACTAAACTCGAGTTTAGTAGATGCTGTATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024683.3-1163s21c1
Sequence:CCGGGTTAACGTGCTAAAGTATAATCTCGAGATTATACTTTAGCACGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024683.3-1110s21c1
Sequence:CCGGCTATTGCCTTCTATGAATTAGCTCGAGCTAATTCATAGAAGGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024683.3-968s21c1
Sequence:CCGGGTGAAGCAGTTTCTCTTCGATCTCGAGATCGAAGAGAAACTGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183275
VALIDATED
TEFM MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor, mitochondrial
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-1110s1c1
Sequence:CCGGACTCACTCTAGTGTTACACTTCTCGAGAAGTGTAACACTAGAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-1081s1c1
Sequence:CCGGGCAAAGACTCAGAGCTCAAATCTCGAGATTTGAGCTCTGAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-1038s1c1
Sequence:CCGGGACTCATTATTACAAGCTGTTCTCGAGAACAGCTTGTAATAATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-1026s1c1
Sequence:CCGGGAAGAGTTGTATGACTCATTACTCGAGTAATGAGTCATACAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-833s1c1
Sequence:CCGGCGTGCTGAGCATAAATCGAAACTCGAGTTTCGATTTATGCTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183275.2-1049s21c1
Sequence:CCGGGAAGAGTTGTATGACTCATTACTCGAGTAATGAGTCATACAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183275.2-1133s21c1
Sequence:CCGGACTCACTCTAGTGTTACACTTCTCGAGAAGTGTAACACTAGAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183275.2-1104s21c1
Sequence:CCGGGCAAAGACTCAGAGCTCAAATCTCGAGATTTGAGCTCTGAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183275.2-856s21c1
Sequence:CCGGCGTGCTGAGCATAAATCGAAACTCGAGTTTCGATTTATGCTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183275
VALIDATED
TEFM MISSION shRNA shRNA Plasmid DNA
transcription elongation factor, mitochondrial
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-1110s1c1
Sequence:CCGGACTCACTCTAGTGTTACACTTCTCGAGAAGTGTAACACTAGAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-1081s1c1
Sequence:CCGGGCAAAGACTCAGAGCTCAAATCTCGAGATTTGAGCTCTGAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-1038s1c1
Sequence:CCGGGACTCATTATTACAAGCTGTTCTCGAGAACAGCTTGTAATAATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-1026s1c1
Sequence:CCGGGAAGAGTTGTATGACTCATTACTCGAGTAATGAGTCATACAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-833s1c1
Sequence:CCGGCGTGCTGAGCATAAATCGAAACTCGAGTTTCGATTTATGCTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183275.2-1049s21c1
Sequence:CCGGGAAGAGTTGTATGACTCATTACTCGAGTAATGAGTCATACAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183275.2-1133s21c1
Sequence:CCGGACTCACTCTAGTGTTACACTTCTCGAGAAGTGTAACACTAGAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183275.2-1104s21c1
Sequence:CCGGGCAAAGACTCAGAGCTCAAATCTCGAGATTTGAGCTCTGAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183275.2-856s21c1
Sequence:CCGGCGTGCTGAGCATAAATCGAAACTCGAGTTTCGATTTATGCTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183275
VALIDATED
TEFM MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor, mitochondrial
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-1110s1c1
Sequence:CCGGACTCACTCTAGTGTTACACTTCTCGAGAAGTGTAACACTAGAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-1081s1c1
Sequence:CCGGGCAAAGACTCAGAGCTCAAATCTCGAGATTTGAGCTCTGAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-1038s1c1
Sequence:CCGGGACTCATTATTACAAGCTGTTCTCGAGAACAGCTTGTAATAATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-1026s1c1
Sequence:CCGGGAAGAGTTGTATGACTCATTACTCGAGTAATGAGTCATACAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183275.1-833s1c1
Sequence:CCGGCGTGCTGAGCATAAATCGAAACTCGAGTTTCGATTTATGCTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183275.2-1049s21c1
Sequence:CCGGGAAGAGTTGTATGACTCATTACTCGAGTAATGAGTCATACAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183275.2-1133s21c1
Sequence:CCGGACTCACTCTAGTGTTACACTTCTCGAGAAGTGTAACACTAGAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183275.2-1104s21c1
Sequence:CCGGGCAAAGACTCAGAGCTCAAATCTCGAGATTTGAGCTCTGAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183275.2-856s21c1
Sequence:CCGGCGTGCTGAGCATAAATCGAAACTCGAGTTTCGATTTATGCTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks