EMAIL THIS PAGE TO A FRIEND

TEK

TEK tyrosine kinase, endothelial

Synonyms: CD202B TIE-2 TIE2 VMCM VMCM1
Gene ID:
Human(7010) Summary: The TEK receptor tyrosine kinase is expressed almost exclusively in endothelial cells in mice, rats, and humans. This receptor possesses a unique extracellular domain containing 2 immunoglobulin-like loops separated by 3 epidermal growth factor-like repeats that are connected to 3 fibronectin type III-like repeats. The ligand for the receptor is angiopoietin-1. Defects in TEK are associated with inherited venous malformations; the TEK signaling pathway appears to be critical for endothelial cell-smooth muscle cell communication in venous morphogenesis. TEK is closely related to the TIE receptor tyrosine kinase. [provided by RefSeq, Jul 2008]
Mouse(21687) endothelial-specific receptor tyrosine kinase
Rat(89804) TEK tyrosine kinase, endothelial
Zebrafish(30747) TEK tyrosine kinase, endothelial
dog(403714) TEK tyrosine kinase, endothelial
domestic cat(101091977) TEK tyrosine kinase, endothelial
chicken(427368) TEK tyrosine kinase, endothelial
cow(280939) TEK tyrosine kinase, endothelial
domestic guinea pig(100713324) TEK tyrosine kinase, endothelial
naked mole-rat(101710501) TEK tyrosine kinase, endothelial
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503999 Anti-phospho-TIE2 (pTyr1108) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301315 Anti-phospho-TIE2 (pTyr992) antibody produced in rabbit affinity isolated antibody human
western blot pricing
T6577 Anti-TEK (391-405) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
T6702 Anti-TEK (46-60) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1412072 ANTI-TEK antibody produced in mouse clone 2D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412073 ANTI-TEK antibody produced in mouse clone 3C1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412074 ANTI-TEK antibody produced in mouse clone 1G10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412075 ANTI-TEK antibody produced in mouse clone 2D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412076 ANTI-TEK antibody produced in mouse clone 6G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412077 ANTI-TEK antibody produced in mouse clone 5G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412078 ANTI-TEK antibody produced in mouse clone 2G2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412265 ANTI-TEK antibody produced in mouse clone 4G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412266 ANTI-TEK antibody produced in mouse clone 2G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412267 ANTI-TEK antibody produced in mouse clone 4C4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412268 ANTI-TEK antibody produced in mouse clone 4G10, purified immunoglobulin, buffered aqueous solution human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA011738 Anti-TEK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA073265 Anti-TEK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
T3192 Anti-Tie 2 antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, neutralization, western blot pricing
SAB4502942 Anti-TIE2, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
WH0007010M2 Monoclonal Anti-TEK antibody produced in mouse clone 3F8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404458 Monoclonal Anti-TEK antibody produced in mouse clone 1A4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C8863 7-Cyclopentyl-5-(4-phenoxyphenyl)-7H-pyrrolo[2,3‑d]pyrimidin-4-ylamine ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000459 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000459 siRNAs that have been validated in the lab human pricing
NM_001105737 Rosetta Predictions rat pricing
NM_013690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000459 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185199 validated 1100
1 SASI_Hs01_00185198 validated 444
2 SASI_Hs01_00185200 predicted 1200
3 SASI_Hs01_00185203 predicted 995
4 SASI_Hs01_00185204 predicted 2841
5 SASI_Hs01_00185205 predicted 1880
6 SASI_Hs02_00302594 predicted 1867
7 SASI_Hs02_00302595 predicted 3707
8 SASI_Hs01_00185206 predicted 2475
9 SASI_Hs02_00302596 predicted 2612
10 SASI_Hs01_00185201 predicted 3680
11 SASI_Hs01_00185202 predicted 3370
12 SASI_Hs01_00185207 predicted 2306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212036 predicted 2748
2 SASI_Rn02_00212037 predicted 523
3 SASI_Rn02_00212038 predicted 2809
4 SASI_Rn02_00212039 predicted 3607
5 SASI_Rn02_00212040 predicted 649
6 SASI_Rn02_00212041 predicted 2955
7 SASI_Rn02_00212042 predicted 703
8 SASI_Rn02_00212043 predicted 365
9 SASI_Rn02_00212044 predicted 1405
10 SASI_Rn02_00212045 predicted 2544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322578 predicted 1554
2 SASI_Mm02_00322579 predicted 1519
3 SASI_Mm01_00185117 predicted 1638
4 SASI_Mm01_00185118 predicted 543
5 SASI_Mm01_00185120 predicted 2400
6 SASI_Mm01_00185122 predicted 1233
7 SASI_Mm02_00322580 predicted 2007
8 SASI_Mm01_00185121 predicted 378
9 SASI_Mm01_00185123 predicted 666
10 SASI_Mm01_00185125 predicted 746
11 SASI_Mm01_00185116 predicted 1727
12 SASI_Mm01_00185119 predicted 3005
13 SASI_Mm01_00185124 predicted 2648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013690
TEK MISSION shRNA Bacterial Glycerol Stock
TEK tyrosine kinase, endothelial
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013690.2-839s21c1
Sequence:CCGGCCGGCATGAAGTACCTGATATCTCGAGATATCAGGTACTTCATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013690.2-2343s21c1
Sequence:CCGGTCCATCATCATCCGGTATAAGCTCGAGCTTATACCGGATGATGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013690.2-4096s21c1
Sequence:CCGGCATAAGATACTGTTCGTTAAACTCGAGTTTAACGAACAGTATCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013690.2-2016s21c1
Sequence:CCGGTTGACTTGGCAACCGATATTTCTCGAGAAATATCGGTTGCCAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-2878s1c1
Sequence:CCGGCGCATCAAGAAGGATGGGTTACTCGAGTAACCCATCCTTCTTGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-538s1c1
Sequence:CCGGGCCTTAATGAACCAGCACCAACTCGAGTTGGTGCTGGTTCATTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-2368s1c1
Sequence:CCGGCGGTATAAGGTTCAGGGCAAACTCGAGTTTGCCCTGAACCTTATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-1659s1c1
Sequence:CCGGGCCTTTCAACATTTCCGTCAACTCGAGTTGACGGAAATGTTGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-852s1c1
Sequence:CCGGCGGCATGAAGTACCTTGATATCTCGAGATATCAAGGTACTTCATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013690
TEK MISSION shRNA shRNA Plasmid DNA
TEK tyrosine kinase, endothelial
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013690.2-839s21c1
Sequence:CCGGCCGGCATGAAGTACCTGATATCTCGAGATATCAGGTACTTCATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013690.2-2343s21c1
Sequence:CCGGTCCATCATCATCCGGTATAAGCTCGAGCTTATACCGGATGATGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013690.2-4096s21c1
Sequence:CCGGCATAAGATACTGTTCGTTAAACTCGAGTTTAACGAACAGTATCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013690.2-2016s21c1
Sequence:CCGGTTGACTTGGCAACCGATATTTCTCGAGAAATATCGGTTGCCAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-2878s1c1
Sequence:CCGGCGCATCAAGAAGGATGGGTTACTCGAGTAACCCATCCTTCTTGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-538s1c1
Sequence:CCGGGCCTTAATGAACCAGCACCAACTCGAGTTGGTGCTGGTTCATTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-2368s1c1
Sequence:CCGGCGGTATAAGGTTCAGGGCAAACTCGAGTTTGCCCTGAACCTTATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-1659s1c1
Sequence:CCGGGCCTTTCAACATTTCCGTCAACTCGAGTTGACGGAAATGTTGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-852s1c1
Sequence:CCGGCGGCATGAAGTACCTTGATATCTCGAGATATCAAGGTACTTCATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013690
TEK MISSION shRNA Lentiviral Transduction Particles
TEK tyrosine kinase, endothelial
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013690.2-839s21c1
Sequence:CCGGCCGGCATGAAGTACCTGATATCTCGAGATATCAGGTACTTCATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013690.2-2343s21c1
Sequence:CCGGTCCATCATCATCCGGTATAAGCTCGAGCTTATACCGGATGATGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013690.2-4096s21c1
Sequence:CCGGCATAAGATACTGTTCGTTAAACTCGAGTTTAACGAACAGTATCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013690.2-2016s21c1
Sequence:CCGGTTGACTTGGCAACCGATATTTCTCGAGAAATATCGGTTGCCAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-2878s1c1
Sequence:CCGGCGCATCAAGAAGGATGGGTTACTCGAGTAACCCATCCTTCTTGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-538s1c1
Sequence:CCGGGCCTTAATGAACCAGCACCAACTCGAGTTGGTGCTGGTTCATTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-2368s1c1
Sequence:CCGGCGGTATAAGGTTCAGGGCAAACTCGAGTTTGCCCTGAACCTTATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-1659s1c1
Sequence:CCGGGCCTTTCAACATTTCCGTCAACTCGAGTTGACGGAAATGTTGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013690.1-852s1c1
Sequence:CCGGCGGCATGAAGTACCTTGATATCTCGAGATATCAAGGTACTTCATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000459
TEK MISSION shRNA Bacterial Glycerol Stock
TEK tyrosine kinase, endothelial
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000459.3-1004s21c1
Sequence:CCGGGTGTACTCGGCCAGGTATATACTCGAGTATATACCTGGCCGAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000459.3-3746s21c1
Sequence:CCGGTACGTGAATACCACGCTTTATCTCGAGATAAAGCGTGGTATTCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000459.3-4104s21c1
Sequence:CCGGCGTGAGTACAATTAGTATAATCTCGAGATTATACTAATTGTACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000459.x-3961s1c1
Sequence:CCGGTGGGTGACATTTGGGAGACATCTCGAGATGTCTCCCAAATGTCACCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000459.x-1588s1c1
Sequence:CCGGGCTTCTATACAAACCCGTTAACTCGAGTTAACGGGTTTGTATAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000459.x-520s1c1
Sequence:CCGGCCTACCAGCTACTTTAACTATCTCGAGATAGTTAAAGTAGCTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000459.x-1275s1c1
Sequence:CCGGCGCTACCTACTAATGAAGAAACTCGAGTTTCTTCATTAGTAGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000459.x-1276s1c1
Sequence:CCGGGCTACCTACTAATGAAGAAATCTCGAGATTTCTTCATTAGTAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000459.2-1933s1c1
Sequence:CCGGCCTCCTCCAAGAGGTCTAAATCTCGAGATTTAGACCTCTTGGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000459
TEK MISSION shRNA shRNA Plasmid DNA
TEK tyrosine kinase, endothelial
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000459.3-1004s21c1
Sequence:CCGGGTGTACTCGGCCAGGTATATACTCGAGTATATACCTGGCCGAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000459.3-3746s21c1
Sequence:CCGGTACGTGAATACCACGCTTTATCTCGAGATAAAGCGTGGTATTCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000459.3-4104s21c1
Sequence:CCGGCGTGAGTACAATTAGTATAATCTCGAGATTATACTAATTGTACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000459.x-3961s1c1
Sequence:CCGGTGGGTGACATTTGGGAGACATCTCGAGATGTCTCCCAAATGTCACCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000459.x-1588s1c1
Sequence:CCGGGCTTCTATACAAACCCGTTAACTCGAGTTAACGGGTTTGTATAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000459.x-520s1c1
Sequence:CCGGCCTACCAGCTACTTTAACTATCTCGAGATAGTTAAAGTAGCTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000459.x-1275s1c1
Sequence:CCGGCGCTACCTACTAATGAAGAAACTCGAGTTTCTTCATTAGTAGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000459.x-1276s1c1
Sequence:CCGGGCTACCTACTAATGAAGAAATCTCGAGATTTCTTCATTAGTAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000459.2-1933s1c1
Sequence:CCGGCCTCCTCCAAGAGGTCTAAATCTCGAGATTTAGACCTCTTGGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000459
TEK MISSION shRNA Lentiviral Transduction Particles
TEK tyrosine kinase, endothelial
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000459.3-1004s21c1
Sequence:CCGGGTGTACTCGGCCAGGTATATACTCGAGTATATACCTGGCCGAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000459.3-3746s21c1
Sequence:CCGGTACGTGAATACCACGCTTTATCTCGAGATAAAGCGTGGTATTCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000459.3-4104s21c1
Sequence:CCGGCGTGAGTACAATTAGTATAATCTCGAGATTATACTAATTGTACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000459.x-3961s1c1
Sequence:CCGGTGGGTGACATTTGGGAGACATCTCGAGATGTCTCCCAAATGTCACCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000459.x-1588s1c1
Sequence:CCGGGCTTCTATACAAACCCGTTAACTCGAGTTAACGGGTTTGTATAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000459.x-520s1c1
Sequence:CCGGCCTACCAGCTACTTTAACTATCTCGAGATAGTTAAAGTAGCTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000459.x-1275s1c1
Sequence:CCGGCGCTACCTACTAATGAAGAAACTCGAGTTTCTTCATTAGTAGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000459.x-1276s1c1
Sequence:CCGGGCTACCTACTAATGAAGAAATCTCGAGATTTCTTCATTAGTAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000459.2-1933s1c1
Sequence:CCGGCCTCCTCCAAGAGGTCTAAATCTCGAGATTTAGACCTCTTGGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks