EMAIL THIS PAGE TO A FRIEND

TEKT1

tektin 1

UniProtKB ID: Q969V4, D3DTM7
Gene ID:
Human(83659) Summary: This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is predominantly expressed in the testis and in mouse, tektin 1 mRNA was localized to the spermatocytes and round spermatids in the seminiferous tubules, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
Mouse(21689) tektin 1
Rat(85270) tektin 1
cow(519068) tektin 1
Horse(100072737) tektin 1
dog(403661) tektin 1
chicken(417686) tektin 1
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053285 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053285 Rosetta Predictions human pricing
NM_053508 Rosetta Predictions rat pricing
NM_011569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091186 predicted 320
2 SASI_Hs01_00091187 predicted 540
3 SASI_Hs01_00091188 predicted 853
4 SASI_Hs01_00091189 predicted 334
5 SASI_Hs01_00091190 predicted 373
6 SASI_Hs01_00091191 predicted 708
7 SASI_Hs01_00091192 predicted 592
8 SASI_Hs01_00091193 predicted 792
9 SASI_Hs01_00091194 predicted 1109
10 SASI_Hs02_00361922 predicted 799
11 SASI_Hs01_00091185 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057464 predicted 342
2 SASI_Rn01_00057465 predicted 635
3 SASI_Rn01_00057466 predicted 934
4 SASI_Rn01_00057467 predicted 278
5 SASI_Rn01_00057468 predicted 493
6 SASI_Rn01_00057469 predicted 828
7 SASI_Rn01_00057470 predicted 613
8 SASI_Rn01_00057471 predicted 335
9 SASI_Rn01_00057472 predicted 898
10 SASI_Rn01_00057473 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115525 predicted 850
2 SASI_Mm01_00115526 predicted 940
3 SASI_Mm01_00115527 predicted 292
4 SASI_Mm01_00115528 predicted 323
5 SASI_Mm01_00115529 predicted 518
6 SASI_Mm01_00115530 predicted 925
7 SASI_Mm01_00115531 predicted 1135
8 SASI_Mm01_00115532 predicted 963
9 SASI_Mm01_00115533 predicted 315
10 SASI_Mm01_00115534 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011569
TEKT1 MISSION shRNA Bacterial Glycerol Stock
tektin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-141s1c1
Sequence:CCGGGAGTGGTATATTGCTAACAAACTCGAGTTTGTTAGCAATATACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-667s1c1
Sequence:CCGGCACTCAACAATAACTCACCAACTCGAGTTGGTGAGTTATTGTTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-794s1c1
Sequence:CCGGGAACAATTCAACGGCGCTGAACTCGAGTTCAGCGCCGTTGAATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-1082s1c1
Sequence:CCGGGTGTCGAGATATTGCCCAGTACTCGAGTACTGGGCAATATCTCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-658s1c1
Sequence:CCGGTCTGCTTCTCACTCAACAATACTCGAGTATTGTTGAGTGAGAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011569
TEKT1 MISSION shRNA shRNA Plasmid DNA
tektin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-141s1c1
Sequence:CCGGGAGTGGTATATTGCTAACAAACTCGAGTTTGTTAGCAATATACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-667s1c1
Sequence:CCGGCACTCAACAATAACTCACCAACTCGAGTTGGTGAGTTATTGTTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-794s1c1
Sequence:CCGGGAACAATTCAACGGCGCTGAACTCGAGTTCAGCGCCGTTGAATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-1082s1c1
Sequence:CCGGGTGTCGAGATATTGCCCAGTACTCGAGTACTGGGCAATATCTCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-658s1c1
Sequence:CCGGTCTGCTTCTCACTCAACAATACTCGAGTATTGTTGAGTGAGAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011569
TEKT1 MISSION shRNA Lentiviral Transduction Particles
tektin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-141s1c1
Sequence:CCGGGAGTGGTATATTGCTAACAAACTCGAGTTTGTTAGCAATATACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-667s1c1
Sequence:CCGGCACTCAACAATAACTCACCAACTCGAGTTGGTGAGTTATTGTTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-794s1c1
Sequence:CCGGGAACAATTCAACGGCGCTGAACTCGAGTTCAGCGCCGTTGAATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-1082s1c1
Sequence:CCGGGTGTCGAGATATTGCCCAGTACTCGAGTACTGGGCAATATCTCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011569.1-658s1c1
Sequence:CCGGTCTGCTTCTCACTCAACAATACTCGAGTATTGTTGAGTGAGAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053285
TEKT1 MISSION shRNA Bacterial Glycerol Stock
tektin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-1238s1c1
Sequence:CCGGCCAGGTCAAAGAGAACACCATCTCGAGATGGTGTTCTCTTTGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-1106s1c1
Sequence:CCGGCGCACAATATAGGCTAATGAACTCGAGTTCATTAGCCTATATTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-680s1c1
Sequence:CCGGGCTCAACAACAACTCACCAAACTCGAGTTTGGTGAGTTGTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-1103s1c1
Sequence:CCGGTGTCGCACAATATAGGCTAATCTCGAGATTAGCCTATATTGTGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-360s1c1
Sequence:CCGGCTTGTGAATGTAACTGATGATCTCGAGATCATCAGTTACATTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053285.1-1145s21c1
Sequence:CCGGCCACAATGTCGCAAGATTGAACTCGAGTTCAATCTTGCGACATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053285.1-504s21c1
Sequence:CCGGGTGGAGCATGAGCTGATAAAGCTCGAGCTTTATCAGCTCATGCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053285
TEKT1 MISSION shRNA shRNA Plasmid DNA
tektin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-1238s1c1
Sequence:CCGGCCAGGTCAAAGAGAACACCATCTCGAGATGGTGTTCTCTTTGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-1106s1c1
Sequence:CCGGCGCACAATATAGGCTAATGAACTCGAGTTCATTAGCCTATATTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-680s1c1
Sequence:CCGGGCTCAACAACAACTCACCAAACTCGAGTTTGGTGAGTTGTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-1103s1c1
Sequence:CCGGTGTCGCACAATATAGGCTAATCTCGAGATTAGCCTATATTGTGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-360s1c1
Sequence:CCGGCTTGTGAATGTAACTGATGATCTCGAGATCATCAGTTACATTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053285.1-1145s21c1
Sequence:CCGGCCACAATGTCGCAAGATTGAACTCGAGTTCAATCTTGCGACATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053285.1-504s21c1
Sequence:CCGGGTGGAGCATGAGCTGATAAAGCTCGAGCTTTATCAGCTCATGCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053285
TEKT1 MISSION shRNA Lentiviral Transduction Particles
tektin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-1238s1c1
Sequence:CCGGCCAGGTCAAAGAGAACACCATCTCGAGATGGTGTTCTCTTTGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-1106s1c1
Sequence:CCGGCGCACAATATAGGCTAATGAACTCGAGTTCATTAGCCTATATTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-680s1c1
Sequence:CCGGGCTCAACAACAACTCACCAAACTCGAGTTTGGTGAGTTGTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-1103s1c1
Sequence:CCGGTGTCGCACAATATAGGCTAATCTCGAGATTAGCCTATATTGTGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053285.1-360s1c1
Sequence:CCGGCTTGTGAATGTAACTGATGATCTCGAGATCATCAGTTACATTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053285.1-1145s21c1
Sequence:CCGGCCACAATGTCGCAAGATTGAACTCGAGTTCAATCTTGCGACATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053285.1-504s21c1
Sequence:CCGGGTGGAGCATGAGCTGATAAAGCTCGAGCTTTATCAGCTCATGCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks