EMAIL THIS PAGE TO A FRIEND

TEKT3

tektin 3

UniProtKB ID: Q9BXF9, B2RAS7, D3DTT0, Q8N5R5, Q96M48
Gene ID:
Human(64518) Summary: This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Mouse(71062) tektin 3
Rat(287392) tektin 3
cow(522915) tektin 3
sheep(101115807) tektin 3
dog(479510) tektin 3
chicken(417326) tektin 3
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031898 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031898 Rosetta Predictions human pricing
NM_001024739 Rosetta Predictions rat pricing
NM_027660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201027 predicted 1460
2 SASI_Hs02_00359012 predicted 1052
3 SASI_Hs01_00201029 predicted 794
4 SASI_Hs01_00201031 predicted 1298
5 SASI_Hs01_00201032 predicted 1175
6 SASI_Hs01_00201033 predicted 1127
7 SASI_Hs02_00359013 predicted 1058
8 SASI_Hs02_00359014 predicted 1094
9 SASI_Hs02_00359015 predicted 996
10 SASI_Hs02_00359016 predicted 872
11 SASI_Hs01_00201028 predicted 791
12 SASI_Hs01_00201030 predicted 1108
13 SASI_Hs01_00201034 predicted 459
14 SASI_Hs01_00201035 predicted 610
15 SASI_Hs01_00201036 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110903 predicted 1038
2 SASI_Rn01_00110904 predicted 1356
3 SASI_Rn01_00110905 predicted 999
4 SASI_Rn02_00202610 predicted 1143
5 SASI_Rn01_00110906 predicted 784
6 SASI_Rn01_00110907 predicted 1023
7 SASI_Rn01_00110908 predicted 1114
8 SASI_Rn01_00110909 predicted 1260
9 SASI_Rn01_00110911 predicted 932
10 SASI_Rn01_00110912 predicted 476
11 SASI_Rn01_00110910 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184731 predicted 1391
2 SASI_Mm01_00184732 predicted 1401
3 SASI_Mm01_00184733 predicted 1165
4 SASI_Mm01_00184734 predicted 758
5 SASI_Mm01_00184735 predicted 1033
6 SASI_Mm01_00184736 predicted 1258
7 SASI_Mm01_00184737 predicted 1175
8 SASI_Mm01_00184738 predicted 1026
9 SASI_Mm01_00184739 predicted 1023
10 SASI_Mm01_00184740 predicted 655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027660
TEKT3 MISSION shRNA Bacterial Glycerol Stock
tektin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-593s1c1
Sequence:CCGGCGAGTCAATGACTTAGCGTTTCTCGAGAAACGCTAAGTCATTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-843s1c1
Sequence:CCGGGAATGAGGCAACATCTGGATACTCGAGTATCCAGATGTTGCCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-228s1c1
Sequence:CCGGGTACCATAACATCGAGCTATACTCGAGTATAGCTCGATGTTATGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-939s1c1
Sequence:CCGGCCCTCCGGATTGATGATAAATCTCGAGATTTATCATCAATCCGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-1403s1c1
Sequence:CCGGCGCCTTGTTAACGAGGTCTATCTCGAGATAGACCTCGTTAACAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027660
TEKT3 MISSION shRNA shRNA Plasmid DNA
tektin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-593s1c1
Sequence:CCGGCGAGTCAATGACTTAGCGTTTCTCGAGAAACGCTAAGTCATTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-843s1c1
Sequence:CCGGGAATGAGGCAACATCTGGATACTCGAGTATCCAGATGTTGCCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-228s1c1
Sequence:CCGGGTACCATAACATCGAGCTATACTCGAGTATAGCTCGATGTTATGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-939s1c1
Sequence:CCGGCCCTCCGGATTGATGATAAATCTCGAGATTTATCATCAATCCGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-1403s1c1
Sequence:CCGGCGCCTTGTTAACGAGGTCTATCTCGAGATAGACCTCGTTAACAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027660
TEKT3 MISSION shRNA Lentiviral Transduction Particles
tektin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-593s1c1
Sequence:CCGGCGAGTCAATGACTTAGCGTTTCTCGAGAAACGCTAAGTCATTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-843s1c1
Sequence:CCGGGAATGAGGCAACATCTGGATACTCGAGTATCCAGATGTTGCCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-228s1c1
Sequence:CCGGGTACCATAACATCGAGCTATACTCGAGTATAGCTCGATGTTATGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-939s1c1
Sequence:CCGGCCCTCCGGATTGATGATAAATCTCGAGATTTATCATCAATCCGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027660.1-1403s1c1
Sequence:CCGGCGCCTTGTTAACGAGGTCTATCTCGAGATAGACCTCGTTAACAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031898
TEKT3 MISSION shRNA Bacterial Glycerol Stock
tektin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-438s1c1
Sequence:CCGGCCGACATAATTCGGAGAAACTCTCGAGAGTTTCTCCGAATTATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-616s1c1
Sequence:CCGGGCACTTACTGATGTGAAGAAACTCGAGTTTCTTCACATCAGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-475s1c1
Sequence:CCGGCGCCTGATTCAAGACAAATATCTCGAGATATTTGTCTTGAATCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-212s1c1
Sequence:CCGGCCCACTCCAATTTGACCCATACTCGAGTATGGGTCAAATTGGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-1053s1c1
Sequence:CCGGCGCTAAGCTAAGAGACGACATCTCGAGATGTCGTCTCTTAGCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031898.2-767s21c1
Sequence:CCGGGTAGCCCGAGAATGTCTATTTCTCGAGAAATAGACATTCTCGGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031898.2-402s21c1
Sequence:CCGGCACAGAGGGTGTCCGAGAATACTCGAGTATTCTCGGACACCCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031898.2-845s21c1
Sequence:CCGGCTGACGGAAGTTGATACTATTCTCGAGAATAGTATCAACTTCCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031898
TEKT3 MISSION shRNA shRNA Plasmid DNA
tektin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-438s1c1
Sequence:CCGGCCGACATAATTCGGAGAAACTCTCGAGAGTTTCTCCGAATTATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-616s1c1
Sequence:CCGGGCACTTACTGATGTGAAGAAACTCGAGTTTCTTCACATCAGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-475s1c1
Sequence:CCGGCGCCTGATTCAAGACAAATATCTCGAGATATTTGTCTTGAATCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-212s1c1
Sequence:CCGGCCCACTCCAATTTGACCCATACTCGAGTATGGGTCAAATTGGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-1053s1c1
Sequence:CCGGCGCTAAGCTAAGAGACGACATCTCGAGATGTCGTCTCTTAGCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031898.2-767s21c1
Sequence:CCGGGTAGCCCGAGAATGTCTATTTCTCGAGAAATAGACATTCTCGGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031898.2-402s21c1
Sequence:CCGGCACAGAGGGTGTCCGAGAATACTCGAGTATTCTCGGACACCCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031898.2-845s21c1
Sequence:CCGGCTGACGGAAGTTGATACTATTCTCGAGAATAGTATCAACTTCCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031898
TEKT3 MISSION shRNA Lentiviral Transduction Particles
tektin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-438s1c1
Sequence:CCGGCCGACATAATTCGGAGAAACTCTCGAGAGTTTCTCCGAATTATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-616s1c1
Sequence:CCGGGCACTTACTGATGTGAAGAAACTCGAGTTTCTTCACATCAGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-475s1c1
Sequence:CCGGCGCCTGATTCAAGACAAATATCTCGAGATATTTGTCTTGAATCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-212s1c1
Sequence:CCGGCCCACTCCAATTTGACCCATACTCGAGTATGGGTCAAATTGGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031898.1-1053s1c1
Sequence:CCGGCGCTAAGCTAAGAGACGACATCTCGAGATGTCGTCTCTTAGCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031898.2-767s21c1
Sequence:CCGGGTAGCCCGAGAATGTCTATTTCTCGAGAAATAGACATTCTCGGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031898.2-402s21c1
Sequence:CCGGCACAGAGGGTGTCCGAGAATACTCGAGTATTCTCGGACACCCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031898.2-845s21c1
Sequence:CCGGCTGACGGAAGTTGATACTATTCTCGAGAATAGTATCAACTTCCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks