EMAIL THIS PAGE TO A FRIEND

TEKT4

tektin 4

UniProtKB ID: Q8WW24
Gene ID:
Mouse(71840) tektin 4
Rat(302991) tektin 4
chicken(416527) tektin 4
dog(490081) tektin 4
cow(510343) tektin 4
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144705 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144705 Rosetta Predictions human pricing
NM_001013965 Rosetta Predictions rat pricing
NM_027951 Rosetta Predictions mouse pricing
XM_128462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172391 predicted 819
2 SASI_Hs01_00172393 predicted 694
3 SASI_Hs01_00172394 predicted 1024
4 SASI_Hs01_00172395 predicted 997
5 SASI_Hs01_00172396 predicted 1167
6 SASI_Hs01_00172397 predicted 642
7 SASI_Hs01_00172398 predicted 659
8 SASI_Hs01_00172399 predicted 1115
9 SASI_Hs01_00172400 predicted 342
10 SASI_Hs02_00364644 predicted 712
11 SASI_Hs01_00172392 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053158 predicted 940
2 SASI_Rn01_00053159 predicted 519
3 SASI_Rn02_00201290 predicted 602
4 SASI_Rn01_00053160 predicted 1017
5 SASI_Rn01_00053161 predicted 392
6 SASI_Rn01_00053162 predicted 727
7 SASI_Rn01_00053163 predicted 747
8 SASI_Rn01_00053164 predicted 557
9 SASI_Rn01_00053165 predicted 1263
10 SASI_Rn01_00053166 predicted 1039
11 SASI_Rn01_00053157 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332959 predicted 411
2 SASI_Mm02_00332960 predicted 957
3 SASI_Mm02_00332961 predicted 1054
4 SASI_Mm02_00332962 predicted 888
5 SASI_Mm02_00332963 predicted 571
6 SASI_Mm02_00332964 predicted 806
7 SASI_Mm02_00332965 predicted 777
8 SASI_Mm02_00332966 predicted 848
9 SASI_Mm02_00332967 predicted 973
10 SASI_Mm02_00332968 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257216 predicted 972
2 SASI_Mm01_00257217 predicted 1066
3 SASI_Mm01_00257218 predicted 900
4 SASI_Mm01_00257219 predicted 821
5 SASI_Mm01_00257220 predicted 1026
6 SASI_Mm01_00257221 predicted 982
7 SASI_Mm01_00257222 predicted 863
8 SASI_Mm01_00257223 predicted 987
9 SASI_Mm01_00257224 predicted 1038
10 SASI_Mm01_00257225 predicted 1157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144705
TEKT4 MISSION shRNA Bacterial Glycerol Stock
tektin 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-1076s21c1
Sequence:CCGGAGCAGGCCATCAAGGACAAAGCTCGAGCTTTGTCCTTGATGGCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-1205s21c1
Sequence:CCGGAGCTGAACATGTCCCTCACAGCTCGAGCTGTGAGGGACATGTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-596s21c1
Sequence:CCGGCCGAGCTCATCCGGAACATTCCTCGAGGAATGTTCCGGATGAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-705s21c1
Sequence:CCGGAGACAAGATGGAGGCCTACAACTCGAGTTGTAGGCCTCCATCTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-830s21c1
Sequence:CCGGCCAAGTTCACGCAGGACAATCCTCGAGGATTGTCCTGCGTGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144705.2-220s1c1
Sequence:CCGGGAGTGGTTCCAGAACTGCTATCTCGAGATAGCAGTTCTGGAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144705.2-624s1c1
Sequence:CCGGGCTGAAGAGAACCATCATGCACTCGAGTGCATGATGGTTCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144705.2-501s1c1
Sequence:CCGGCTTCTCCATCACCACTGACAACTCGAGTTGTCAGTGGTGATGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144705.2-621s1c1
Sequence:CCGGGCTGCTGAAGAGAACCATCATCTCGAGATGATGGTTCTCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144705
TEKT4 MISSION shRNA shRNA Plasmid DNA
tektin 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-1076s21c1
Sequence:CCGGAGCAGGCCATCAAGGACAAAGCTCGAGCTTTGTCCTTGATGGCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-1205s21c1
Sequence:CCGGAGCTGAACATGTCCCTCACAGCTCGAGCTGTGAGGGACATGTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-596s21c1
Sequence:CCGGCCGAGCTCATCCGGAACATTCCTCGAGGAATGTTCCGGATGAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-705s21c1
Sequence:CCGGAGACAAGATGGAGGCCTACAACTCGAGTTGTAGGCCTCCATCTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-830s21c1
Sequence:CCGGCCAAGTTCACGCAGGACAATCCTCGAGGATTGTCCTGCGTGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144705.2-220s1c1
Sequence:CCGGGAGTGGTTCCAGAACTGCTATCTCGAGATAGCAGTTCTGGAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144705.2-624s1c1
Sequence:CCGGGCTGAAGAGAACCATCATGCACTCGAGTGCATGATGGTTCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144705.2-501s1c1
Sequence:CCGGCTTCTCCATCACCACTGACAACTCGAGTTGTCAGTGGTGATGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144705.2-621s1c1
Sequence:CCGGGCTGCTGAAGAGAACCATCATCTCGAGATGATGGTTCTCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144705
TEKT4 MISSION shRNA Lentiviral Transduction Particles
tektin 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-1076s21c1
Sequence:CCGGAGCAGGCCATCAAGGACAAAGCTCGAGCTTTGTCCTTGATGGCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-1205s21c1
Sequence:CCGGAGCTGAACATGTCCCTCACAGCTCGAGCTGTGAGGGACATGTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-596s21c1
Sequence:CCGGCCGAGCTCATCCGGAACATTCCTCGAGGAATGTTCCGGATGAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-705s21c1
Sequence:CCGGAGACAAGATGGAGGCCTACAACTCGAGTTGTAGGCCTCCATCTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144705.2-830s21c1
Sequence:CCGGCCAAGTTCACGCAGGACAATCCTCGAGGATTGTCCTGCGTGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144705.2-220s1c1
Sequence:CCGGGAGTGGTTCCAGAACTGCTATCTCGAGATAGCAGTTCTGGAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144705.2-624s1c1
Sequence:CCGGGCTGAAGAGAACCATCATGCACTCGAGTGCATGATGGTTCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144705.2-501s1c1
Sequence:CCGGCTTCTCCATCACCACTGACAACTCGAGTTGTCAGTGGTGATGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144705.2-621s1c1
Sequence:CCGGGCTGCTGAAGAGAACCATCATCTCGAGATGATGGTTCTCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027951
TEKT4 MISSION shRNA Bacterial Glycerol Stock
tektin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-210s21c1
Sequence:CCGGATATGAAGTGGCCTGCAATACCTCGAGGTATTGCAGGCCACTTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-896s21c1
Sequence:CCGGAGACGTGGGCCAAGTTCAATCCTCGAGGATTGAACTTGGCCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-1287s21c1
Sequence:CCGGCATGTCCCTCAGAGCGTTAAACTCGAGTTTAACGCTCTGAGGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-767s21c1
Sequence:CCGGAGATGAACTGGTCGGACAAAGCTCGAGCTTTGTCCGACCAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-735s21c1
Sequence:CCGGACGGCTGAACAGGGAGCATAACTCGAGTTATGCTCCCTGTTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027951
TEKT4 MISSION shRNA shRNA Plasmid DNA
tektin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-210s21c1
Sequence:CCGGATATGAAGTGGCCTGCAATACCTCGAGGTATTGCAGGCCACTTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-896s21c1
Sequence:CCGGAGACGTGGGCCAAGTTCAATCCTCGAGGATTGAACTTGGCCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-1287s21c1
Sequence:CCGGCATGTCCCTCAGAGCGTTAAACTCGAGTTTAACGCTCTGAGGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-767s21c1
Sequence:CCGGAGATGAACTGGTCGGACAAAGCTCGAGCTTTGTCCGACCAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-735s21c1
Sequence:CCGGACGGCTGAACAGGGAGCATAACTCGAGTTATGCTCCCTGTTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027951
TEKT4 MISSION shRNA Lentiviral Transduction Particles
tektin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-210s21c1
Sequence:CCGGATATGAAGTGGCCTGCAATACCTCGAGGTATTGCAGGCCACTTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-896s21c1
Sequence:CCGGAGACGTGGGCCAAGTTCAATCCTCGAGGATTGAACTTGGCCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-1287s21c1
Sequence:CCGGCATGTCCCTCAGAGCGTTAAACTCGAGTTTAACGCTCTGAGGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-767s21c1
Sequence:CCGGAGATGAACTGGTCGGACAAAGCTCGAGCTTTGTCCGACCAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027951.1-735s21c1
Sequence:CCGGACGGCTGAACAGGGAGCATAACTCGAGTTATGCTCCCTGTTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks