EMAIL THIS PAGE TO A FRIEND
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_156349 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_156349 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_156349 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144674 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU192251 MISSION® esiRNA esiRNA targeting mouse Tekt5 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144674 Rosetta Predictions human pricing
NM_001014224 Rosetta Predictions rat pricing
NM_001099275 Rosetta Predictions mouse pricing
XM_358761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099581 predicted 676
2 SASI_Hs01_00099582 predicted 952
3 SASI_Hs01_00099583 predicted 1053
4 SASI_Hs01_00099584 predicted 1180
5 SASI_Hs02_00364572 predicted 787
6 SASI_Hs01_00099586 predicted 509
7 SASI_Hs01_00099587 predicted 1101
8 SASI_Hs01_00099588 predicted 537
9 SASI_Hs01_00099589 predicted 1285
10 SASI_Hs01_00099590 predicted 319
11 SASI_Hs01_00099585 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088028 predicted 370
2 SASI_Rn01_00088029 predicted 637
3 SASI_Rn01_00088030 predicted 1110
4 SASI_Rn01_00088031 predicted 1270
5 SASI_Rn01_00088032 predicted 1249
6 SASI_Rn01_00088034 predicted 779
7 SASI_Rn01_00088035 predicted 897
8 SASI_Rn02_00201761 predicted 1095
9 SASI_Rn01_00088036 predicted 1024
10 SASI_Rn02_00201762 predicted 864
11 SASI_Rn01_00088033 predicted 990
12 SASI_Rn01_00088037 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301521 predicted 671
2 SASI_Mm02_00301522 predicted 790
3 SASI_Mm02_00301523 predicted 1031
4 SASI_Mm02_00301524 predicted 796
5 SASI_Mm02_00301525 predicted 461
6 SASI_Mm02_00301526 predicted 909
7 SASI_Mm02_00301527 predicted 770
8 SASI_Mm02_00301528 predicted 428
9 SASI_Mm02_00301529 predicted 770
10 SASI_Mm02_00301530 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208088 predicted 681
2 SASI_Mm01_00208089 predicted 806
3 SASI_Mm01_00208090 predicted 1049
4 SASI_Mm01_00208091 predicted 923
5 SASI_Mm01_00208092 predicted 782
6 SASI_Mm01_00208093 predicted 1209
7 SASI_Mm01_00208094 predicted 732
8 SASI_Mm01_00208095 predicted 1066
9 SASI_Mm01_00208096 predicted 1105
10 SASI_Mm01_00208097 predicted 1132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_156349
TEKT5 MISSION shRNA Bacterial Glycerol Stock
tektin 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-837s1c1
Sequence:CCGGGCACAGTATATTGACGAGAATCTCGAGATTCTCGTCAATATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-1347s1c1
Sequence:CCGGGCTGCTGTCACAAGACAAGATCTCGAGATCTTGTCTTGTGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-648s1c1
Sequence:CCGGGTCCATGACAACGTGGAGAAACTCGAGTTTCTCCACGTTGTCATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-1553s1c1
Sequence:CCGGCCAGGATAGAAGCTGGGACTTCTCGAGAAGTCCCAGCTTCTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-1173s1c1
Sequence:CCGGGCGTTCCTAATGAGCTACGTTCTCGAGAACGTAGCTCATTAGGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_156349
TEKT5 MISSION shRNA shRNA Plasmid DNA
tektin 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-837s1c1
Sequence:CCGGGCACAGTATATTGACGAGAATCTCGAGATTCTCGTCAATATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-1347s1c1
Sequence:CCGGGCTGCTGTCACAAGACAAGATCTCGAGATCTTGTCTTGTGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-648s1c1
Sequence:CCGGGTCCATGACAACGTGGAGAAACTCGAGTTTCTCCACGTTGTCATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-1553s1c1
Sequence:CCGGCCAGGATAGAAGCTGGGACTTCTCGAGAAGTCCCAGCTTCTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-1173s1c1
Sequence:CCGGGCGTTCCTAATGAGCTACGTTCTCGAGAACGTAGCTCATTAGGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_156349
TEKT5 MISSION shRNA Lentiviral Transduction Particles
tektin 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-837s1c1
Sequence:CCGGGCACAGTATATTGACGAGAATCTCGAGATTCTCGTCAATATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-1347s1c1
Sequence:CCGGGCTGCTGTCACAAGACAAGATCTCGAGATCTTGTCTTGTGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-648s1c1
Sequence:CCGGGTCCATGACAACGTGGAGAAACTCGAGTTTCTCCACGTTGTCATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-1553s1c1
Sequence:CCGGCCAGGATAGAAGCTGGGACTTCTCGAGAAGTCCCAGCTTCTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_156349.3-1173s1c1
Sequence:CCGGGCGTTCCTAATGAGCTACGTTCTCGAGAACGTAGCTCATTAGGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144674
TEKT5 MISSION shRNA Bacterial Glycerol Stock
tektin 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-226s1c1
Sequence:CCGGCCTAGCCTCTTCTACAAGATACTCGAGTATCTTGTAGAAGAGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-963s1c1
Sequence:CCGGGTTCAGTAACGACAACATCAACTCGAGTTGATGTTGTCGTTACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-866s1c1
Sequence:CCGGAGTGCTTTAACCTGAGAAATACTCGAGTATTTCTCAGGTTAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-960s1c1
Sequence:CCGGCAAGTTCAGTAACGACAACATCTCGAGATGTTGTCGTTACTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-99s1c1
Sequence:CCGGCGCCAGTTACTGTGGTCCCAACTCGAGTTGGGACCACAGTAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144674.1-321s21c1
Sequence:CCGGCGCACTCTTCTCTCGCTATAGCTCGAGCTATAGCGAGAGAAGAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144674.1-172s21c1
Sequence:CCGGGAATGCTATCAGCCCTACTACCTCGAGGTAGTAGGGCTGATAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144674.1-666s21c1
Sequence:CCGGGAAGAGGATTGGGATTGATTTCTCGAGAAATCAATCCCAATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144674
TEKT5 MISSION shRNA shRNA Plasmid DNA
tektin 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-226s1c1
Sequence:CCGGCCTAGCCTCTTCTACAAGATACTCGAGTATCTTGTAGAAGAGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-963s1c1
Sequence:CCGGGTTCAGTAACGACAACATCAACTCGAGTTGATGTTGTCGTTACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-866s1c1
Sequence:CCGGAGTGCTTTAACCTGAGAAATACTCGAGTATTTCTCAGGTTAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-960s1c1
Sequence:CCGGCAAGTTCAGTAACGACAACATCTCGAGATGTTGTCGTTACTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-99s1c1
Sequence:CCGGCGCCAGTTACTGTGGTCCCAACTCGAGTTGGGACCACAGTAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144674.1-321s21c1
Sequence:CCGGCGCACTCTTCTCTCGCTATAGCTCGAGCTATAGCGAGAGAAGAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144674.1-172s21c1
Sequence:CCGGGAATGCTATCAGCCCTACTACCTCGAGGTAGTAGGGCTGATAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144674.1-666s21c1
Sequence:CCGGGAAGAGGATTGGGATTGATTTCTCGAGAAATCAATCCCAATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144674
TEKT5 MISSION shRNA Lentiviral Transduction Particles
tektin 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-226s1c1
Sequence:CCGGCCTAGCCTCTTCTACAAGATACTCGAGTATCTTGTAGAAGAGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-963s1c1
Sequence:CCGGGTTCAGTAACGACAACATCAACTCGAGTTGATGTTGTCGTTACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-866s1c1
Sequence:CCGGAGTGCTTTAACCTGAGAAATACTCGAGTATTTCTCAGGTTAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-960s1c1
Sequence:CCGGCAAGTTCAGTAACGACAACATCTCGAGATGTTGTCGTTACTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144674.1-99s1c1
Sequence:CCGGCGCCAGTTACTGTGGTCCCAACTCGAGTTGGGACCACAGTAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144674.1-321s21c1
Sequence:CCGGCGCACTCTTCTCTCGCTATAGCTCGAGCTATAGCGAGAGAAGAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144674.1-172s21c1
Sequence:CCGGGAATGCTATCAGCCCTACTACCTCGAGGTAGTAGGGCTGATAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144674.1-666s21c1
Sequence:CCGGGAAGAGGATTGGGATTGATTTCTCGAGAAATCAATCCCAATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks