EMAIL THIS PAGE TO A FRIEND

TELO2

telomere maintenance 2

Synonyms: CLK2 TEL2
UniProtKB ID: Q9Y4R8, D3DU73, O75168, Q7LDV4, Q9BR21
Gene ID:
Human(9894) Summary: This gene encodes a protein that functions as an S-phase checkpoint protein in the cell cycle. The protein may also play a role in DNA repair.[provided by RefSeq, Mar 2009]
Mouse(71718) TEL2, telomere maintenance 2, homolog (S. cerevisiae)
Rat(302986) TEL2, telomere maintenance 2, homolog (S. cerevisiae)
Zebrafish(777634) TEL2, telomere maintenance 2, homolog (S. cerevisiae)
chicken(416757) TEL2, telomere maintenance 2, homolog (S. cerevisiae)
dog(490076) TEL2, telomere maintenance 2, homolog (S. cerevisiae)
domestic cat(101085261) TEL2, telomere maintenance 2, homolog (S. cerevisiae)
cow(526097) TEL2, telomere maintenance 2, homolog (S. cerevisiae)
sheep(101109236) TEL2, telomere maintenance 2, homolog (S. cerevisiae)
naked mole-rat(101712286) TEL2, telomere maintenance 2, homolog (S. cerevisiae)
domestic guinea pig(100728749) TEL2, telomere maintenance 2, homolog (S. cerevisiae)
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016111 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156541 MISSION® esiRNA esiRNA human TELO2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016111 Rosetta Predictions human pricing
XM_001059179 Rosetta Predictions rat pricing
XM_220236 Rosetta Predictions rat pricing
NM_027880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104382 predicted 512
2 SASI_Hs01_00104383 predicted 1778
3 SASI_Hs01_00104384 predicted 2323
4 SASI_Hs01_00104385 predicted 2353
5 SASI_Hs01_00104386 predicted 656
6 SASI_Hs01_00104387 predicted 2368
7 SASI_Hs01_00104388 predicted 1432
8 SASI_Hs01_00104389 predicted 1305
9 SASI_Hs01_00104390 predicted 1988
10 SASI_Hs01_00104391 predicted 2044
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292274 predicted 2178
2 SASI_Rn02_00292275 predicted 1566
3 SASI_Rn02_00292276 predicted 954
4 SASI_Rn02_00292277 predicted 597
5 SASI_Rn02_00292278 predicted 1843
6 SASI_Rn02_00292279 predicted 1774
7 SASI_Rn02_00292280 predicted 577
8 SASI_Rn02_00292281 predicted 580
9 SASI_Rn02_00292282 predicted 2452
10 SASI_Rn02_00292283 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379145 predicted 897
2 SASI_Rn02_00379146 predicted 416
3 SASI_Rn02_00379147 predicted 565
4 SASI_Rn02_00379148 predicted 1150
5 SASI_Rn02_00379149 predicted 415
6 SASI_Rn02_00379150 predicted 1674
7 SASI_Rn02_00379151 predicted 856
8 SASI_Rn02_00379152 predicted 822
9 SASI_Rn02_00379153 predicted 959
10 SASI_Rn02_00379154 predicted 1550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085135 predicted 2145
2 SASI_Mm01_00085136 predicted 1301
3 SASI_Mm01_00085137 predicted 1609
4 SASI_Mm01_00085138 predicted 2501
5 SASI_Mm01_00085139 predicted 1563
6 SASI_Mm02_00332840 predicted 927
7 SASI_Mm01_00085140 predicted 525
8 SASI_Mm01_00085141 predicted 985
9 SASI_Mm01_00085142 predicted 1233
10 SASI_Mm01_00085143 predicted 1907
11 SASI_Mm01_00085134 predicted 2555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027880
TELO2 MISSION shRNA Bacterial Glycerol Stock
telomere maintenance 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027880.1-2146s21c1
Sequence:CCGGAGTTCTATGGCCTAAACTATACTCGAGTATAGTTTAGGCCATAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027880.1-2996s21c1
Sequence:CCGGTGAAGTAGGCTCCTATCAATCCTCGAGGATTGATAGGAGCCTACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027880.1-1614s1c1
Sequence:CCGGCCTCTCCTGAAATTCCAATATCTCGAGATATTGGAATTTCAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027880.1-1963s21c1
Sequence:CCGGGGCTTGAGGGCCTGGTATATACTCGAGTATATACCAGGCCCTCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027880.1-2626s21c1
Sequence:CCGGTTCGCTTCCACGTTGACATTTCTCGAGAAATGTCAACGTGGAAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027880.1-1341s21c1
Sequence:CCGGCTCCTCATACAGGTGCTTAAGCTCGAGCTTAAGCACCTGTATGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184637    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027880.1-3085s1c1
Sequence:CCGGCCAAGGGACACAACAACCTTTCTCGAGAAAGGTTGTTGTGTCCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027880
TELO2 MISSION shRNA shRNA Plasmid DNA
telomere maintenance 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027880.1-2146s21c1
Sequence:CCGGAGTTCTATGGCCTAAACTATACTCGAGTATAGTTTAGGCCATAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027880.1-2996s21c1
Sequence:CCGGTGAAGTAGGCTCCTATCAATCCTCGAGGATTGATAGGAGCCTACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027880.1-1614s1c1
Sequence:CCGGCCTCTCCTGAAATTCCAATATCTCGAGATATTGGAATTTCAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027880.1-1963s21c1
Sequence:CCGGGGCTTGAGGGCCTGGTATATACTCGAGTATATACCAGGCCCTCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027880.1-2626s21c1
Sequence:CCGGTTCGCTTCCACGTTGACATTTCTCGAGAAATGTCAACGTGGAAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027880.1-1341s21c1
Sequence:CCGGCTCCTCATACAGGTGCTTAAGCTCGAGCTTAAGCACCTGTATGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184637    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027880.1-3085s1c1
Sequence:CCGGCCAAGGGACACAACAACCTTTCTCGAGAAAGGTTGTTGTGTCCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027880
TELO2 MISSION shRNA Lentiviral Transduction Particles
telomere maintenance 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027880.1-2146s21c1
Sequence:CCGGAGTTCTATGGCCTAAACTATACTCGAGTATAGTTTAGGCCATAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027880.1-2996s21c1
Sequence:CCGGTGAAGTAGGCTCCTATCAATCCTCGAGGATTGATAGGAGCCTACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027880.1-1614s1c1
Sequence:CCGGCCTCTCCTGAAATTCCAATATCTCGAGATATTGGAATTTCAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027880.1-1963s21c1
Sequence:CCGGGGCTTGAGGGCCTGGTATATACTCGAGTATATACCAGGCCCTCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027880.1-2626s21c1
Sequence:CCGGTTCGCTTCCACGTTGACATTTCTCGAGAAATGTCAACGTGGAAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027880.1-1341s21c1
Sequence:CCGGCTCCTCATACAGGTGCTTAAGCTCGAGCTTAAGCACCTGTATGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184637    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027880.1-3085s1c1
Sequence:CCGGCCAAGGGACACAACAACCTTTCTCGAGAAAGGTTGTTGTGTCCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016111
VALIDATED
TELO2 MISSION shRNA Bacterial Glycerol Stock
telomere maintenance 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016111.2-1093s21c1
Sequence:CCGGAGAACAAGAAGGCCCAGTTTGCTCGAGCAAACTGGGCCTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016111.2-1786s21c1
Sequence:CCGGTGACCACGTCTGAGGACATAGCTCGAGCTATGTCCTCAGACGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016111.2-2895s21c1
Sequence:CCGGTAGTGCAGCCAGTCCGCTAAACTCGAGTTTAGCGGACTGGCTGCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016111.2-2420s21c1
Sequence:CCGGCCTGATGTGCCTGGCTGTTAACTCGAGTTAACAGCCAGGCACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016111.2-2002s21c1
Sequence:CCGGATCTGACCTCACAGTTCTATGCTCGAGCATAGAACTGTGAGGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016111.1-1095s1c1
Sequence:CCGGGAACAAGAAGGCCCAGTTTGTCTCGAGACAAACTGGGCCTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016111
VALIDATED
TELO2 MISSION shRNA shRNA Plasmid DNA
telomere maintenance 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016111.2-1093s21c1
Sequence:CCGGAGAACAAGAAGGCCCAGTTTGCTCGAGCAAACTGGGCCTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016111.2-1786s21c1
Sequence:CCGGTGACCACGTCTGAGGACATAGCTCGAGCTATGTCCTCAGACGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016111.2-2895s21c1
Sequence:CCGGTAGTGCAGCCAGTCCGCTAAACTCGAGTTTAGCGGACTGGCTGCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016111.2-2420s21c1
Sequence:CCGGCCTGATGTGCCTGGCTGTTAACTCGAGTTAACAGCCAGGCACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016111.2-2002s21c1
Sequence:CCGGATCTGACCTCACAGTTCTATGCTCGAGCATAGAACTGTGAGGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016111.1-1095s1c1
Sequence:CCGGGAACAAGAAGGCCCAGTTTGTCTCGAGACAAACTGGGCCTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016111
VALIDATED
TELO2 MISSION shRNA Lentiviral Transduction Particles
telomere maintenance 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016111.2-1093s21c1
Sequence:CCGGAGAACAAGAAGGCCCAGTTTGCTCGAGCAAACTGGGCCTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016111.2-1786s21c1
Sequence:CCGGTGACCACGTCTGAGGACATAGCTCGAGCTATGTCCTCAGACGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016111.2-2895s21c1
Sequence:CCGGTAGTGCAGCCAGTCCGCTAAACTCGAGTTTAGCGGACTGGCTGCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016111.2-2420s21c1
Sequence:CCGGCCTGATGTGCCTGGCTGTTAACTCGAGTTAACAGCCAGGCACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016111.2-2002s21c1
Sequence:CCGGATCTGACCTCACAGTTCTATGCTCGAGCATAGAACTGTGAGGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016111.1-1095s1c1
Sequence:CCGGGAACAAGAAGGCCCAGTTTGTCTCGAGACAAACTGGGCCTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks