EMAIL THIS PAGE TO A FRIEND

TEN1

TEN1 CST complex subunit

Synonyms: C17orf106
UniProtKB ID: Q86WV5, I3L0C7
Gene ID:
Human(100134934) Summary: C17ORF106, or TEN1, appears to function in a telomere-associated complex with STN1 (OBFC1; MIM 613128) and CTC1 (C17ORF68; MIM 613129) (Miyake et al., 2009 [PubMed 19854130]
Mouse(69535) TEN1 telomerase capping complex subunit
Rat(360664) TEN1 telomerase capping complex subunit
dog(609475) TEN1 telomerase capping complex subunit homolog (S. cerevisiae)
domestic cat(101082704) TEN1 telomerase capping complex subunit homolog (S. cerevisiae)
cow(510634) TEN1 telomerase capping complex subunit homolog (S. cerevisiae)
sheep(101107370) TEN1 telomerase capping complex subunit homolog (S. cerevisiae)
domestic guinea pig(100721015) TEN1 CST complex subunit
naked mole-rat(101704284) TEN1 CST complex subunit
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027107 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027107 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027107 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001113324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001113324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001113324 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU070141 MISSION® esiRNA esiRNA targeting mouse 2310004N24Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113324 Rosetta Predictions human pricing
NM_001108307 Rosetta Predictions rat pricing
XM_340940 Rosetta Predictions rat pricing
XM_181318 Rosetta Predictions mouse pricing
XM_910489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325691 predicted 419
2 SASI_Hs02_00325692 predicted 378
3 SASI_Hs02_00325693 predicted 380
4 SASI_Hs02_00325694 predicted 454
5 SASI_Hs02_00325695 predicted 547
6 SASI_Hs02_00325696 predicted 762
7 SASI_Hs02_00325697 predicted 379
8 SASI_Hs02_00325698 predicted 761
9 SASI_Hs02_00325699 predicted 334
10 SASI_Hs02_00325700 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237369 predicted 217
2 SASI_Rn02_00237370 predicted 318
3 SASI_Rn02_00237371 predicted 444
4 SASI_Rn02_00237372 predicted 336
5 SASI_Rn02_00237373 predicted 498
6 SASI_Rn02_00237374 predicted 551
7 SASI_Rn02_00237375 predicted 292
8 SASI_Rn02_00237376 predicted 564
9 SASI_Rn02_00237377 predicted 379
10 SASI_Rn02_00237378 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154193 predicted 82
2 SASI_Rn01_00154194 predicted 172
3 SASI_Rn01_00154195 predicted 296
4 SASI_Rn01_00154196 predicted 193
5 SASI_Rn01_00154197 predicted 354
6 SASI_Rn01_00154198 predicted 32
7 SASI_Rn01_00154199 predicted 149
8 SASI_Rn01_00154200 predicted 240
9 SASI_Rn01_00154201 predicted 67
10 SASI_Rn01_00154202 predicted 149
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_181318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284676 predicted 466
2 SASI_Mm01_00284677 predicted 344
3 SASI_Mm01_00284678 predicted 669
4 SASI_Mm01_00284679 predicted 412
5 SASI_Mm02_00425442 predicted 592
6 SASI_Mm02_00425443 predicted 306
7 SASI_Mm01_00284681 predicted 369
8 SASI_Mm01_00284682 predicted 475
9 SASI_Mm02_00425444 predicted 308
10 SASI_Mm01_00284683 predicted 578
11 SASI_Mm01_00284680 predicted 588
12 SASI_Mm01_00284684 predicted 651
13 SASI_Mm01_00284685 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435620 predicted 464
2 SASI_Mm02_00435621 predicted 338
3 SASI_Mm02_00435622 predicted 667
4 SASI_Mm02_00435623 predicted 403
5 SASI_Mm02_00435624 predicted 312
6 SASI_Mm02_00435625 predicted 226
7 SASI_Mm02_00435626 predicted 314
8 SASI_Mm02_00435627 predicted 254
9 SASI_Mm02_00435628 predicted 574
10 SASI_Mm02_00435629 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027107
VALIDATED
TEN1 MISSION shRNA Bacterial Glycerol Stock
TEN1 CST complex subunit
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-310s21c1
Sequence:CCGGTCCGCAGAAACCTGATCAGTGCTCGAGCACTGATCAGGTTTCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-570s21c1
Sequence:CCGGCACCTGCTCCTCAATCGATTCCTCGAGGAATCGATTGAGGAGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-522s21c1
Sequence:CCGGAGAAGAGGCAGCAGCCAATAGCTCGAGCTATTGGCTGCTGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-239s21c1
Sequence:CCGGGGAAGCACACTGCGAACATTTCTCGAGAAATGTTCGCAGTGTGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-726s21c1
Sequence:CCGGGCGGGAAGAGGTGGAGTTTAACTCGAGTTAAACTCCACCTCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-334s21c1
Sequence:CCGGACTGCTTGTCTGCACCAACTTCTCGAGAAGTTGGTGCAGACAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027107
VALIDATED
TEN1 MISSION shRNA shRNA Plasmid DNA
TEN1 CST complex subunit
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-310s21c1
Sequence:CCGGTCCGCAGAAACCTGATCAGTGCTCGAGCACTGATCAGGTTTCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-570s21c1
Sequence:CCGGCACCTGCTCCTCAATCGATTCCTCGAGGAATCGATTGAGGAGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-522s21c1
Sequence:CCGGAGAAGAGGCAGCAGCCAATAGCTCGAGCTATTGGCTGCTGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-239s21c1
Sequence:CCGGGGAAGCACACTGCGAACATTTCTCGAGAAATGTTCGCAGTGTGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-726s21c1
Sequence:CCGGGCGGGAAGAGGTGGAGTTTAACTCGAGTTAAACTCCACCTCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-334s21c1
Sequence:CCGGACTGCTTGTCTGCACCAACTTCTCGAGAAGTTGGTGCAGACAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027107
VALIDATED
TEN1 MISSION shRNA Lentiviral Transduction Particles
TEN1 CST complex subunit
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-310s21c1
Sequence:CCGGTCCGCAGAAACCTGATCAGTGCTCGAGCACTGATCAGGTTTCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-570s21c1
Sequence:CCGGCACCTGCTCCTCAATCGATTCCTCGAGGAATCGATTGAGGAGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-522s21c1
Sequence:CCGGAGAAGAGGCAGCAGCCAATAGCTCGAGCTATTGGCTGCTGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-239s21c1
Sequence:CCGGGGAAGCACACTGCGAACATTTCTCGAGAAATGTTCGCAGTGTGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-726s21c1
Sequence:CCGGGCGGGAAGAGGTGGAGTTTAACTCGAGTTAAACTCCACCTCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027107.1-334s21c1
Sequence:CCGGACTGCTTGTCTGCACCAACTTCTCGAGAAGTTGGTGCAGACAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001113324
TEN1 MISSION shRNA Bacterial Glycerol Stock
TEN1 CST complex subunit
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113324.1-766s21c1
Sequence:CCGGGCCTTGTCTGGAGCTCGAAAGCTCGAGCTTTCGAGCTCCAGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-448s21c1
Sequence:CCGGCGATCAGCACCAGGTTCTTGTCTCGAGACAAGAACCTGGTGCTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-365s21c1
Sequence:CCGGGGGAGCACGCTGAGAACATTTCTCGAGAAATGTTCTCAGCGTGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-393s21c1
Sequence:CCGGTGTGCCTCTATGACATGATTCCTCGAGGAATCATGTCATAGAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113324.1-837s21c1
Sequence:CCGGCAGCAATGAGAACCCAGAAAGCTCGAGCTTTCTGGGTTCTCATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-597s21c1
Sequence:CCGGTGAACCTGCCCTTGTTGGAACCTCGAGGTTCCAACAAGGGCAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-421s21c1
Sequence:CCGGAGTAACACTGATGGCTCAGCACTCGAGTGCTGAGCCATCAGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001113324
TEN1 MISSION shRNA shRNA Plasmid DNA
TEN1 CST complex subunit
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113324.1-766s21c1
Sequence:CCGGGCCTTGTCTGGAGCTCGAAAGCTCGAGCTTTCGAGCTCCAGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-448s21c1
Sequence:CCGGCGATCAGCACCAGGTTCTTGTCTCGAGACAAGAACCTGGTGCTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-365s21c1
Sequence:CCGGGGGAGCACGCTGAGAACATTTCTCGAGAAATGTTCTCAGCGTGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-393s21c1
Sequence:CCGGTGTGCCTCTATGACATGATTCCTCGAGGAATCATGTCATAGAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113324.1-837s21c1
Sequence:CCGGCAGCAATGAGAACCCAGAAAGCTCGAGCTTTCTGGGTTCTCATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-597s21c1
Sequence:CCGGTGAACCTGCCCTTGTTGGAACCTCGAGGTTCCAACAAGGGCAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-421s21c1
Sequence:CCGGAGTAACACTGATGGCTCAGCACTCGAGTGCTGAGCCATCAGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001113324
TEN1 MISSION shRNA Lentiviral Transduction Particles
TEN1 CST complex subunit
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113324.1-766s21c1
Sequence:CCGGGCCTTGTCTGGAGCTCGAAAGCTCGAGCTTTCGAGCTCCAGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-448s21c1
Sequence:CCGGCGATCAGCACCAGGTTCTTGTCTCGAGACAAGAACCTGGTGCTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-365s21c1
Sequence:CCGGGGGAGCACGCTGAGAACATTTCTCGAGAAATGTTCTCAGCGTGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-393s21c1
Sequence:CCGGTGTGCCTCTATGACATGATTCCTCGAGGAATCATGTCATAGAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113324.1-837s21c1
Sequence:CCGGCAGCAATGAGAACCCAGAAAGCTCGAGCTTTCTGGGTTCTCATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-597s21c1
Sequence:CCGGTGAACCTGCCCTTGTTGGAACCTCGAGGTTCCAACAAGGGCAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113324.1-421s21c1
Sequence:CCGGAGTAACACTGATGGCTCAGCACTCGAGTGCTGAGCCATCAGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks