EMAIL THIS PAGE TO A FRIEND

TENC1

tensin like C1 domain containing phosphatase (tensin 2)

Synonyms: C1-TEN C1TEN TNS2
Gene ID:
Human(23371) Summary: The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(209039) tensin like C1 domain-containing phosphatase
Rat(315326) tensin like C1 domain containing phosphatase (tensin 2)
domestic cat(101082248) tensin like C1 domain containing phosphatase (tensin 2)
Horse(100146672) tensin like C1 domain containing phosphatase (tensin 2)
dog(477599) tensin like C1 domain containing phosphatase (tensin 2)
naked mole-rat(101715726) tensin like C1 domain containing phosphatase (tensin 2)
domestic guinea pig(100735402) tensin like C1 domain containing phosphatase (tensin 2)
cow(540153) tensin like C1 domain containing phosphatase (tensin 2)
sheep(101110224) tensin like C1 domain containing phosphatase (tensin 2)
220 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153533 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153533 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153533 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_170754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170754 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015319 Rosetta Predictions human pricing
NM_170754 Rosetta Predictions human pricing
NM_198316 Rosetta Predictions human pricing
NM_001108114 Rosetta Predictions rat pricing
NM_153533 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347589 predicted 3958
2 SASI_Hs01_00103157 predicted 4430
3 SASI_Hs01_00103158 predicted 2609
4 SASI_Hs01_00103159 predicted 2608
5 SASI_Hs01_00103160 predicted 999
6 SASI_Hs01_00103161 predicted 898
7 SASI_Hs01_00103162 predicted 3710
8 SASI_Hs01_00103163 predicted 1062
9 SASI_Hs01_00103164 predicted 1087
10 SASI_Hs01_00103165 predicted 2744
11 SASI_Hs01_00103166 predicted 4362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367726 predicted 3872
2 SASI_Hs01_00180205 predicted 4341
3 SASI_Hs01_00180206 predicted 2516
4 SASI_Hs01_00180207 predicted 2514
5 SASI_Hs01_00180208 predicted 913
6 SASI_Hs01_00180209 predicted 810
7 SASI_Hs01_00180210 predicted 3620
8 SASI_Hs01_00180211 predicted 968
9 SASI_Hs01_00180212 predicted 1000
10 SASI_Hs01_00180213 predicted 2656
11 SASI_Hs01_00180214 predicted 4267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371867 predicted 3696
2 SASI_Hs01_00231499 predicted 4163
3 SASI_Hs01_00231500 predicted 2342
4 SASI_Hs01_00231501 predicted 2342
5 SASI_Hs01_00231502 predicted 733
6 SASI_Hs01_00231503 predicted 641
7 SASI_Hs01_00231504 predicted 3445
8 SASI_Hs01_00231505 predicted 797
9 SASI_Hs01_00231506 predicted 827
10 SASI_Hs01_00231507 predicted 2480
11 SASI_Hs01_00231508 predicted 4099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235494 predicted 2360
2 SASI_Rn02_00235495 predicted 2218
3 SASI_Rn02_00235496 predicted 795
4 SASI_Rn02_00235497 predicted 692
5 SASI_Rn02_00235498 predicted 1416
6 SASI_Rn02_00235499 predicted 1083
7 SASI_Rn02_00235500 predicted 843
8 SASI_Rn02_00235501 predicted 1551
9 SASI_Rn02_00235502 predicted 438
10 SASI_Rn02_00235503 predicted 2551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052242 predicted 3810
2 SASI_Mm01_00052243 predicted 3451
3 SASI_Mm01_00052244 predicted 2200
4 SASI_Mm02_00343296 predicted 2517
5 SASI_Mm01_00052246 predicted 3552
6 SASI_Mm01_00052247 predicted 2661
7 SASI_Mm01_00052248 predicted 1069
8 SASI_Mm01_00052249 predicted 2399
9 SASI_Mm01_00052250 predicted 3650
10 SASI_Mm01_00052251 predicted 1916
11 SASI_Mm01_00052245 predicted 3357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153533
TENC1 MISSION shRNA Bacterial Glycerol Stock
tensin like C1 domain containing phosphatase (tensin 2)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153533.2-817s21c1
Sequence:CCGGGTCATCGTCTCTGCTTATATGCTCGAGCATATAAGCAGAGACGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153533.2-3657s21c1
Sequence:CCGGAGAACAGCTGGTCCGCCATTTCTCGAGAAATGGCGGACCAGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153533.2-3717s21c1
Sequence:CCGGTTGTCCCACTGAGCCCTATTTCTCGAGAAATAGGGCTCAGTGGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153533.2-1410s21c1
Sequence:CCGGTCCCTCTGTCTCCGTGGATTACTCGAGTAATCCACGGAGACAGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-941s1c1
Sequence:CCGGCCTCAAGATCTACCAGTCTATCTCGAGATAGACTGGTAGATCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-3690s1c1
Sequence:CCGGCCTAGCAAAGATCCTCTAGAACTCGAGTTCTAGAGGATCTTTGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-4143s1c1
Sequence:CCGGGTCACCTTCATCACCAAAGTTCTCGAGAACTTTGGTGATGAAGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-761s1c1
Sequence:CCGGGAGGAAATTCTGTGAGGACAACTCGAGTTGTCCTCACAGAATTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-2322s1c1
Sequence:CCGGGCCCTGGTAACCTATGGCTATCTCGAGATAGCCATAGGTTACCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153533
TENC1 MISSION shRNA shRNA Plasmid DNA
tensin like C1 domain containing phosphatase (tensin 2)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153533.2-817s21c1
Sequence:CCGGGTCATCGTCTCTGCTTATATGCTCGAGCATATAAGCAGAGACGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153533.2-3657s21c1
Sequence:CCGGAGAACAGCTGGTCCGCCATTTCTCGAGAAATGGCGGACCAGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153533.2-3717s21c1
Sequence:CCGGTTGTCCCACTGAGCCCTATTTCTCGAGAAATAGGGCTCAGTGGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153533.2-1410s21c1
Sequence:CCGGTCCCTCTGTCTCCGTGGATTACTCGAGTAATCCACGGAGACAGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-941s1c1
Sequence:CCGGCCTCAAGATCTACCAGTCTATCTCGAGATAGACTGGTAGATCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-3690s1c1
Sequence:CCGGCCTAGCAAAGATCCTCTAGAACTCGAGTTCTAGAGGATCTTTGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-4143s1c1
Sequence:CCGGGTCACCTTCATCACCAAAGTTCTCGAGAACTTTGGTGATGAAGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-761s1c1
Sequence:CCGGGAGGAAATTCTGTGAGGACAACTCGAGTTGTCCTCACAGAATTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-2322s1c1
Sequence:CCGGGCCCTGGTAACCTATGGCTATCTCGAGATAGCCATAGGTTACCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153533
TENC1 MISSION shRNA Lentiviral Transduction Particles
tensin like C1 domain containing phosphatase (tensin 2)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153533.2-817s21c1
Sequence:CCGGGTCATCGTCTCTGCTTATATGCTCGAGCATATAAGCAGAGACGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153533.2-3657s21c1
Sequence:CCGGAGAACAGCTGGTCCGCCATTTCTCGAGAAATGGCGGACCAGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153533.2-3717s21c1
Sequence:CCGGTTGTCCCACTGAGCCCTATTTCTCGAGAAATAGGGCTCAGTGGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153533.2-1410s21c1
Sequence:CCGGTCCCTCTGTCTCCGTGGATTACTCGAGTAATCCACGGAGACAGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-941s1c1
Sequence:CCGGCCTCAAGATCTACCAGTCTATCTCGAGATAGACTGGTAGATCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-3690s1c1
Sequence:CCGGCCTAGCAAAGATCCTCTAGAACTCGAGTTCTAGAGGATCTTTGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-4143s1c1
Sequence:CCGGGTCACCTTCATCACCAAAGTTCTCGAGAACTTTGGTGATGAAGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-761s1c1
Sequence:CCGGGAGGAAATTCTGTGAGGACAACTCGAGTTGTCCTCACAGAATTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153533.1-2322s1c1
Sequence:CCGGGCCCTGGTAACCTATGGCTATCTCGAGATAGCCATAGGTTACCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170754
VALIDATED
TENC1 MISSION shRNA Bacterial Glycerol Stock
tensin like C1 domain containing phosphatase (tensin 2)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_170754.2-4381s21c1
Sequence:CCGGTCAGAGCCCACATCAACACTGCTCGAGCAGTGTTGATGTGGGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170754.2-3507s21c1
Sequence:CCGGAGAGAGCCAAAGCAATGTCAACTCGAGTTGACATTGCTTTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170754.2-804s21c1
Sequence:CCGGACAGCACGTGGTCGTACTATACTCGAGTATAGTACGACCACGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_170754.2-681s21c1
Sequence:CCGGGCATGACCTGACCCGCTTAAACTCGAGTTTAAGCGGGTCAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_170754.2-440s21c1
Sequence:CCGGCCACCAAATCTCTGAACCACTCTCGAGAGTGGTTCAGAGATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_170754.x-4107s1c1
Sequence:CCGGACTGACGGACAACCAAAGGAACTCGAGTTCCTTTGGTTGTCCGTCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_170754.x-914s1c1
Sequence:CCGGCCACTCTTACCATGCGGAAATCTCGAGATTTCCGCATGGTAAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_170754.x-3507s1c1
Sequence:CCGGAGAGAGCCAAAGCAATGTCAACTCGAGTTGACATTGCTTTGGCTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170754.x-4770s1c1
Sequence:CCGGAGCAGAGATTCAGAGTAGGATCTCGAGATCCTACTCTGAATCTCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_170754.x-440s1c1
Sequence:CCGGCCACCAAATCTCTGAACCACTCTCGAGAGTGGTTCAGAGATTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170754
VALIDATED
TENC1 MISSION shRNA shRNA Plasmid DNA
tensin like C1 domain containing phosphatase (tensin 2)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_170754.2-4381s21c1
Sequence:CCGGTCAGAGCCCACATCAACACTGCTCGAGCAGTGTTGATGTGGGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170754.2-3507s21c1
Sequence:CCGGAGAGAGCCAAAGCAATGTCAACTCGAGTTGACATTGCTTTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170754.2-804s21c1
Sequence:CCGGACAGCACGTGGTCGTACTATACTCGAGTATAGTACGACCACGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_170754.2-681s21c1
Sequence:CCGGGCATGACCTGACCCGCTTAAACTCGAGTTTAAGCGGGTCAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_170754.2-440s21c1
Sequence:CCGGCCACCAAATCTCTGAACCACTCTCGAGAGTGGTTCAGAGATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_170754.x-4107s1c1
Sequence:CCGGACTGACGGACAACCAAAGGAACTCGAGTTCCTTTGGTTGTCCGTCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_170754.x-914s1c1
Sequence:CCGGCCACTCTTACCATGCGGAAATCTCGAGATTTCCGCATGGTAAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_170754.x-3507s1c1
Sequence:CCGGAGAGAGCCAAAGCAATGTCAACTCGAGTTGACATTGCTTTGGCTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170754.x-4770s1c1
Sequence:CCGGAGCAGAGATTCAGAGTAGGATCTCGAGATCCTACTCTGAATCTCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_170754.x-440s1c1
Sequence:CCGGCCACCAAATCTCTGAACCACTCTCGAGAGTGGTTCAGAGATTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170754
VALIDATED
TENC1 MISSION shRNA Lentiviral Transduction Particles
tensin like C1 domain containing phosphatase (tensin 2)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_170754.2-4381s21c1
Sequence:CCGGTCAGAGCCCACATCAACACTGCTCGAGCAGTGTTGATGTGGGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170754.2-3507s21c1
Sequence:CCGGAGAGAGCCAAAGCAATGTCAACTCGAGTTGACATTGCTTTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170754.2-804s21c1
Sequence:CCGGACAGCACGTGGTCGTACTATACTCGAGTATAGTACGACCACGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_170754.2-681s21c1
Sequence:CCGGGCATGACCTGACCCGCTTAAACTCGAGTTTAAGCGGGTCAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_170754.2-440s21c1
Sequence:CCGGCCACCAAATCTCTGAACCACTCTCGAGAGTGGTTCAGAGATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_170754.x-4107s1c1
Sequence:CCGGACTGACGGACAACCAAAGGAACTCGAGTTCCTTTGGTTGTCCGTCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_170754.x-914s1c1
Sequence:CCGGCCACTCTTACCATGCGGAAATCTCGAGATTTCCGCATGGTAAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_170754.x-3507s1c1
Sequence:CCGGAGAGAGCCAAAGCAATGTCAACTCGAGTTGACATTGCTTTGGCTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170754.x-4770s1c1
Sequence:CCGGAGCAGAGATTCAGAGTAGGATCTCGAGATCCTACTCTGAATCTCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_170754.x-440s1c1
Sequence:CCGGCCACCAAATCTCTGAACCACTCTCGAGAGTGGTTCAGAGATTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks