EMAIL THIS PAGE TO A FRIEND

TENM1

teneurin transmembrane protein 1

Synonyms: ODZ1 ODZ3 TEN-M1 TNM TNM1
UniProtKB ID: Q9UKZ4, B2RTR5, Q5JZ17
Gene ID:
Human(10178) Summary: The protein encoded by this gene belongs to the tenascin family and teneurin subfamily. It is expressed in the neurons and may function as a cellular signal transducer. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(23963) teneurin transmembrane protein 1
Rat(298168) teneurin transmembrane protein 1
domestic cat(101096453) teneurin transmembrane protein 1
sheep(101117563) teneurin transmembrane protein 1
domestic guinea pig(100716058) teneurin transmembrane protein 1
naked mole-rat(101717816) teneurin transmembrane protein 1
209 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014253 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014253 Rosetta Predictions human pricing
XM_233103 Rosetta Predictions rat pricing
NM_011855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178127 predicted 6628
2 SASI_Hs02_00345312 predicted 8218
3 SASI_Hs01_00178128 predicted 1284
4 SASI_Hs01_00178129 predicted 1301
5 SASI_Hs01_00178130 predicted 5442
6 SASI_Hs01_00178131 predicted 5115
7 SASI_Hs01_00178133 predicted 6240
8 SASI_Hs01_00178134 predicted 7428
9 SASI_Hs01_00178135 predicted 3383
10 SASI_Hs01_00178136 predicted 7643
11 SASI_Hs01_00178132 predicted 4166
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179282 predicted 5855
2 SASI_Rn01_00179283 predicted 7159
3 SASI_Rn01_00179284 predicted 6231
4 SASI_Rn01_00179285 predicted 3405
5 SASI_Rn01_00179286 predicted 7388
6 SASI_Rn01_00179287 predicted 5054
7 SASI_Rn01_00179288 predicted 3283
8 SASI_Rn01_00179289 predicted 6104
9 SASI_Rn01_00179290 predicted 4524
10 SASI_Rn01_00179291 predicted 7264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321607 predicted 6671
2 SASI_Mm01_00046134 predicted 2358
3 SASI_Mm01_00046135 predicted 1648
4 SASI_Mm01_00046136 predicted 2833
5 SASI_Mm01_00046137 predicted 1206
6 SASI_Mm01_00046139 predicted 8009
7 SASI_Mm01_00046140 predicted 2338
8 SASI_Mm01_00046141 predicted 3438
9 SASI_Mm01_00046142 predicted 7819
10 SASI_Mm02_00321608 predicted 7131
11 SASI_Mm01_00046138 predicted 4087
12 SASI_Mm01_00046143 predicted 7603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014253
TENM1 MISSION shRNA Bacterial Glycerol Stock
teneurin transmembrane protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-5759s1c1
Sequence:CCGGCGGCGTTACATCTTTGAGTATCTCGAGATACTCAAAGATGTAACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-3559s1c1
Sequence:CCGGCCCAGTCATATCAACCATAATCTCGAGATTATGGTTGATATGACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-1068s1c1
Sequence:CCGGCCTATGTGATTGCAGTGCATTCTCGAGAATGCACTGCAATCACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-7719s1c1
Sequence:CCGGCCATTCTCAATAATGCCCATTCTCGAGAATGGGCATTATTGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-2445s1c1
Sequence:CCGGGCTGCAATGTTGTCATGGAAACTCGAGTTTCCATGACAACATTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014253.3-4925s21c1
Sequence:CCGGGTGTCAGCCCAAGGCTATAATCTCGAGATTATAGCCTTGGGCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014253.3-7662s21c1
Sequence:CCGGGCATAGTAACAGCTGATATTACTCGAGTAATATCAGCTGTTACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014253.3-3728s21c1
Sequence:CCGGTCGGGAAACTCCGTTAGTATTCTCGAGAATACTAACGGAGTTTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014253.3-6483s21c1
Sequence:CCGGTAGGAGTAGATGCCAATATAACTCGAGTTATATTGGCATCTACTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014253
TENM1 MISSION shRNA shRNA Plasmid DNA
teneurin transmembrane protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-5759s1c1
Sequence:CCGGCGGCGTTACATCTTTGAGTATCTCGAGATACTCAAAGATGTAACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-3559s1c1
Sequence:CCGGCCCAGTCATATCAACCATAATCTCGAGATTATGGTTGATATGACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-1068s1c1
Sequence:CCGGCCTATGTGATTGCAGTGCATTCTCGAGAATGCACTGCAATCACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-7719s1c1
Sequence:CCGGCCATTCTCAATAATGCCCATTCTCGAGAATGGGCATTATTGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-2445s1c1
Sequence:CCGGGCTGCAATGTTGTCATGGAAACTCGAGTTTCCATGACAACATTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014253.3-4925s21c1
Sequence:CCGGGTGTCAGCCCAAGGCTATAATCTCGAGATTATAGCCTTGGGCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014253.3-7662s21c1
Sequence:CCGGGCATAGTAACAGCTGATATTACTCGAGTAATATCAGCTGTTACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014253.3-3728s21c1
Sequence:CCGGTCGGGAAACTCCGTTAGTATTCTCGAGAATACTAACGGAGTTTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014253.3-6483s21c1
Sequence:CCGGTAGGAGTAGATGCCAATATAACTCGAGTTATATTGGCATCTACTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014253
TENM1 MISSION shRNA Lentiviral Transduction Particles
teneurin transmembrane protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-5759s1c1
Sequence:CCGGCGGCGTTACATCTTTGAGTATCTCGAGATACTCAAAGATGTAACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-3559s1c1
Sequence:CCGGCCCAGTCATATCAACCATAATCTCGAGATTATGGTTGATATGACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-1068s1c1
Sequence:CCGGCCTATGTGATTGCAGTGCATTCTCGAGAATGCACTGCAATCACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-7719s1c1
Sequence:CCGGCCATTCTCAATAATGCCCATTCTCGAGAATGGGCATTATTGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014253.1-2445s1c1
Sequence:CCGGGCTGCAATGTTGTCATGGAAACTCGAGTTTCCATGACAACATTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014253.3-4925s21c1
Sequence:CCGGGTGTCAGCCCAAGGCTATAATCTCGAGATTATAGCCTTGGGCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014253.3-7662s21c1
Sequence:CCGGGCATAGTAACAGCTGATATTACTCGAGTAATATCAGCTGTTACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014253.3-3728s21c1
Sequence:CCGGTCGGGAAACTCCGTTAGTATTCTCGAGAATACTAACGGAGTTTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014253.3-6483s21c1
Sequence:CCGGTAGGAGTAGATGCCAATATAACTCGAGTTATATTGGCATCTACTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011855
TENM1 MISSION shRNA Bacterial Glycerol Stock
teneurin transmembrane protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-6976s1c1
Sequence:CCGGGCGCAGAGATTACATCTCTTTCTCGAGAAAGAGATGTAATCTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-1086s1c1
Sequence:CCGGGCCTTGTTACTAGCCTATGTACTCGAGTACATAGGCTAGTAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-6624s1c1
Sequence:CCGGCGGTATAGTTATGATCTGAATCTCGAGATTCAGATCATAACTATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-7164s1c1
Sequence:CCGGCCTGACTTTGAGGTCATCATTCTCGAGAATGATGACCTCAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-4769s1c1
Sequence:CCGGGCACCTACATACCATGAACTTCTCGAGAAGTTCATGGTATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011855
TENM1 MISSION shRNA shRNA Plasmid DNA
teneurin transmembrane protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-6976s1c1
Sequence:CCGGGCGCAGAGATTACATCTCTTTCTCGAGAAAGAGATGTAATCTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-1086s1c1
Sequence:CCGGGCCTTGTTACTAGCCTATGTACTCGAGTACATAGGCTAGTAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-6624s1c1
Sequence:CCGGCGGTATAGTTATGATCTGAATCTCGAGATTCAGATCATAACTATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-7164s1c1
Sequence:CCGGCCTGACTTTGAGGTCATCATTCTCGAGAATGATGACCTCAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-4769s1c1
Sequence:CCGGGCACCTACATACCATGAACTTCTCGAGAAGTTCATGGTATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011855
TENM1 MISSION shRNA Lentiviral Transduction Particles
teneurin transmembrane protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-6976s1c1
Sequence:CCGGGCGCAGAGATTACATCTCTTTCTCGAGAAAGAGATGTAATCTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-1086s1c1
Sequence:CCGGGCCTTGTTACTAGCCTATGTACTCGAGTACATAGGCTAGTAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-6624s1c1
Sequence:CCGGCGGTATAGTTATGATCTGAATCTCGAGATTCAGATCATAACTATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-7164s1c1
Sequence:CCGGCCTGACTTTGAGGTCATCATTCTCGAGAATGATGACCTCAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011855.2-4769s1c1
Sequence:CCGGGCACCTACATACCATGAACTTCTCGAGAAGTTCATGGTATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks