EMAIL THIS PAGE TO A FRIEND

TENM2

teneurin transmembrane protein 2

Synonyms: ODZ2 TEN-M2 TNM2
UniProtKB ID: Q9NT68, Q9ULU2
Gene ID:
Mouse(23964) teneurin transmembrane protein 2
Rat(117242) teneurin transmembrane protein 2
naked mole-rat(101713979) teneurin transmembrane protein 2
domestic guinea pig(100735565) teneurin transmembrane protein 2
cow(100138541) teneurin transmembrane protein 2
sheep(101120408) teneurin transmembrane protein 2
domestic cat(101085858) teneurin transmembrane protein 2
185 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001122679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001122679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001122679 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122679 Rosetta Predictions human pricing
XM_047995 Rosetta Predictions human pricing
XM_931449 Rosetta Predictions human pricing
XM_931456 Rosetta Predictions human pricing
NM_020088 Rosetta Predictions rat pricing
NM_011856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327206 predicted 7236
2 SASI_Hs02_00327207 predicted 5509
3 SASI_Hs02_00327208 predicted 1721
4 SASI_Hs02_00327209 predicted 5408
5 SASI_Hs02_00327210 predicted 1499
6 SASI_Hs02_00327211 predicted 6058
7 SASI_Hs02_00327212 predicted 4245
8 SASI_Hs02_00327213 predicted 1228
9 SASI_Hs02_00327214 predicted 6233
10 SASI_Hs02_00327215 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_047995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296807 predicted 6354
2 SASI_Hs01_00296808 predicted 4873
3 SASI_Hs01_00296809 predicted 1077
4 SASI_Hs01_00296810 predicted 4770
5 SASI_Hs01_00296811 predicted 847
6 SASI_Hs01_00296812 predicted 3601
7 SASI_Hs01_00296813 predicted 4043
8 SASI_Hs01_00296814 predicted 5103
9 SASI_Hs01_00296815 predicted 5802
10 SASI_Hs01_00296816 predicted 1782
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267458 predicted 296
2 SASI_Hs01_00267459 predicted 354
3 SASI_Hs01_00267460 predicted 216
4 SASI_Hs01_00267461 predicted 229
5 SASI_Hs01_00267462 predicted 217
6 SASI_Hs01_00267463 predicted 312
7 SASI_Hs01_00267464 predicted 223
8 SASI_Hs01_00267465 predicted 248
9 SASI_Hs01_00267466 predicted 232
10 SASI_Hs01_00267467 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294876 predicted 6008
2 SASI_Hs01_00294877 predicted 6262
3 SASI_Hs01_00294878 predicted 4527
4 SASI_Hs01_00294879 predicted 4435
5 SASI_Hs01_00294880 predicted 3266
6 SASI_Hs01_00294881 predicted 3700
7 SASI_Hs01_00294882 predicted 4764
8 SASI_Hs01_00294883 predicted 5466
9 SASI_Hs01_00294884 predicted 1441
10 SASI_Hs01_00294885 predicted 5662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046824 predicted 949
2 SASI_Rn01_00046825 predicted 7374
3 SASI_Rn01_00046826 predicted 2536
4 SASI_Rn01_00046827 predicted 3374
5 SASI_Rn01_00046828 predicted 4883
6 SASI_Rn01_00046829 predicted 3488
7 SASI_Rn02_00262495 predicted 2463
8 SASI_Rn02_00262496 predicted 1192
9 SASI_Rn01_00046831 predicted 5867
10 SASI_Rn01_00046832 predicted 3502
11 SASI_Rn01_00046830 predicted 6509
12 SASI_Rn01_00046833 predicted 1366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187662 predicted 5575
2 SASI_Mm02_00321609 predicted 3317
3 SASI_Mm01_00187663 predicted 5319
4 SASI_Mm01_00187665 predicted 1402
5 SASI_Mm02_00321610 predicted 3966
6 SASI_Mm01_00187668 predicted 2477
7 SASI_Mm02_00321611 predicted 2019
8 SASI_Mm01_00187669 predicted 3442
9 SASI_Mm01_00187670 predicted 1305
10 SASI_Mm01_00187671 predicted 3435
11 SASI_Mm01_00187664 predicted 5881
12 SASI_Mm01_00187666 predicted 5857
13 SASI_Mm01_00187667 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001122679
TENM2 MISSION shRNA Bacterial Glycerol Stock
teneurin transmembrane protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122679.1-9063s21c1
Sequence:CCGGAGTCTGGCCTGAGCTAATTTACTCGAGTAAATTAGCTCAGGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122679.1-4735s21c1
Sequence:CCGGCCCGGAGAGCAGGAGTTATATCTCGAGATATAACTCCTGCTCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122679.1-5517s21c1
Sequence:CCGGCATTGACTATGATCGAAATATCTCGAGATATTTCGATCATAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122679.1-5910s21c1
Sequence:CCGGCATCGGCTACATCCGTAATATCTCGAGATATTACGGATGTAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122679.1-3783s21c1
Sequence:CCGGCATCTTGGAGTTACGAAATAACTCGAGTTATTTCGTAACTCCAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001122679
TENM2 MISSION shRNA shRNA Plasmid DNA
teneurin transmembrane protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122679.1-9063s21c1
Sequence:CCGGAGTCTGGCCTGAGCTAATTTACTCGAGTAAATTAGCTCAGGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122679.1-4735s21c1
Sequence:CCGGCCCGGAGAGCAGGAGTTATATCTCGAGATATAACTCCTGCTCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122679.1-5517s21c1
Sequence:CCGGCATTGACTATGATCGAAATATCTCGAGATATTTCGATCATAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122679.1-5910s21c1
Sequence:CCGGCATCGGCTACATCCGTAATATCTCGAGATATTACGGATGTAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122679.1-3783s21c1
Sequence:CCGGCATCTTGGAGTTACGAAATAACTCGAGTTATTTCGTAACTCCAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001122679
TENM2 MISSION shRNA Lentiviral Transduction Particles
teneurin transmembrane protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122679.1-9063s21c1
Sequence:CCGGAGTCTGGCCTGAGCTAATTTACTCGAGTAAATTAGCTCAGGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122679.1-4735s21c1
Sequence:CCGGCCCGGAGAGCAGGAGTTATATCTCGAGATATAACTCCTGCTCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122679.1-5517s21c1
Sequence:CCGGCATTGACTATGATCGAAATATCTCGAGATATTTCGATCATAGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122679.1-5910s21c1
Sequence:CCGGCATCGGCTACATCCGTAATATCTCGAGATATTACGGATGTAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122679.1-3783s21c1
Sequence:CCGGCATCTTGGAGTTACGAAATAACTCGAGTTATTTCGTAACTCCAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011856
TENM2 MISSION shRNA Bacterial Glycerol Stock
teneurin transmembrane protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011856.2-8607s1c1
Sequence:CCGGCGGCCACAAATTTCTGAGGAACTCGAGTTCCTCAGAAATTTGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011856.2-5625s1c1
Sequence:CCGGCCATTGATTATGACCGAAATACTCGAGTATTTCGGTCATAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011856.2-1282s1c1
Sequence:CCGGGCTGGCATATTTCATAGCAATCTCGAGATTGCTATGAAATATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011856.2-6341s1c1
Sequence:CCGGGCCAGGTTTGATTATACCTATCTCGAGATAGGTATAATCAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011856.2-2512s1c1
Sequence:CCGGCCCTGATTTGTGCAACGGTAACTCGAGTTACCGTTGCACAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011856
TENM2 MISSION shRNA shRNA Plasmid DNA
teneurin transmembrane protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011856.2-8607s1c1
Sequence:CCGGCGGCCACAAATTTCTGAGGAACTCGAGTTCCTCAGAAATTTGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011856.2-5625s1c1
Sequence:CCGGCCATTGATTATGACCGAAATACTCGAGTATTTCGGTCATAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011856.2-1282s1c1
Sequence:CCGGGCTGGCATATTTCATAGCAATCTCGAGATTGCTATGAAATATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011856.2-6341s1c1
Sequence:CCGGGCCAGGTTTGATTATACCTATCTCGAGATAGGTATAATCAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011856.2-2512s1c1
Sequence:CCGGCCCTGATTTGTGCAACGGTAACTCGAGTTACCGTTGCACAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011856
TENM2 MISSION shRNA Lentiviral Transduction Particles
teneurin transmembrane protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011856.2-8607s1c1
Sequence:CCGGCGGCCACAAATTTCTGAGGAACTCGAGTTCCTCAGAAATTTGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011856.2-5625s1c1
Sequence:CCGGCCATTGATTATGACCGAAATACTCGAGTATTTCGGTCATAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011856.2-1282s1c1
Sequence:CCGGGCTGGCATATTTCATAGCAATCTCGAGATTGCTATGAAATATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011856.2-6341s1c1
Sequence:CCGGGCCAGGTTTGATTATACCTATCTCGAGATAGGTATAATCAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011856.2-2512s1c1
Sequence:CCGGCCCTGATTTGTGCAACGGTAACTCGAGTTACCGTTGCACAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks