EMAIL THIS PAGE TO A FRIEND

TENM3

teneurin transmembrane protein 3

Synonyms: MCOPCB9 ODZ3 TNM3 Ten-m3
UniProtKB ID: Q9P273, Q5XUL9, Q96SY2, Q9NV77, Q9NVW1, Q9NZJ2
Gene ID:
Mouse(23965) teneurin transmembrane protein 3
Rat(306451) teneurin transmembrane protein 3
Zebrafish(30155) teneurin transmembrane protein 3
domestic cat(101086900) teneurin transmembrane protein 3
sheep(101108282) teneurin transmembrane protein 3
domestic guinea pig(100723174) teneurin transmembrane protein 3
naked mole-rat(101722796) teneurin transmembrane protein 3
200 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080477 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU012661 MISSION® esiRNA esiRNA targeting mouse Odz3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080477 Rosetta Predictions human pricing
XM_371717 Rosetta Predictions human pricing
XM_931600 Rosetta Predictions human pricing
XM_001058907 Rosetta Predictions rat pricing
XM_224841 Rosetta Predictions rat pricing
NM_011857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315216 predicted 3408
2 SASI_Hs02_00315217 predicted 810
3 SASI_Hs02_00315218 predicted 5021
4 SASI_Hs02_00315219 predicted 1943
5 SASI_Hs02_00315220 predicted 3581
6 SASI_Hs02_00315221 predicted 3129
7 SASI_Hs02_00315222 predicted 3398
8 SASI_Hs02_00315223 predicted 993
9 SASI_Hs02_00315224 predicted 5207
10 SASI_Hs02_00315225 predicted 3674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281482 predicted 7211
2 SASI_Hs01_00281483 predicted 896
3 SASI_Hs01_00281484 predicted 5171
4 SASI_Hs01_00281485 predicted 5100
5 SASI_Hs01_00281486 predicted 3672
6 SASI_Hs01_00281487 predicted 3208
7 SASI_Hs01_00281488 predicted 3485
8 SASI_Hs01_00281489 predicted 1077
9 SASI_Hs01_00281490 predicted 6232
10 SASI_Hs01_00281491 predicted 5294
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296852 predicted 238
2 SASI_Hs01_00296853 predicted 281
3 SASI_Hs01_00296854 predicted 349
4 SASI_Hs01_00296855 predicted 498
5 SASI_Hs01_00296856 predicted 416
6 SASI_Hs01_00296857 predicted 215
7 SASI_Hs01_00296858 predicted 473
8 SASI_Hs01_00296859 predicted 281
9 SASI_Hs01_00296860 predicted 344
10 SASI_Hs01_00296861 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291213 predicted 4643
2 SASI_Rn02_00291214 predicted 7393
3 SASI_Rn02_00291215 predicted 910
4 SASI_Rn02_00291216 predicted 5167
5 SASI_Rn02_00291217 predicted 3248
6 SASI_Rn02_00291218 predicted 2703
7 SASI_Rn02_00291219 predicted 6474
8 SASI_Rn02_00291220 predicted 5523
9 SASI_Rn02_00291221 predicted 5187
10 SASI_Rn02_00291222 predicted 5631
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224841 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382306 predicted 4642
2 SASI_Rn02_00382307 predicted 7397
3 SASI_Rn02_00382308 predicted 908
4 SASI_Rn02_00382309 predicted 5174
5 SASI_Rn02_00382310 predicted 3253
6 SASI_Rn02_00382311 predicted 2700
7 SASI_Rn02_00382312 predicted 6479
8 SASI_Rn02_00382313 predicted 5529
9 SASI_Rn02_00382314 predicted 5190
10 SASI_Rn02_00382315 predicted 5634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131094 predicted 5562
2 SASI_Mm02_00321612 predicted 6865
3 SASI_Mm01_00131095 predicted 3254
4 SASI_Mm01_00131096 predicted 7240
5 SASI_Mm01_00131097 predicted 5857
6 SASI_Mm01_00131098 predicted 3981
7 SASI_Mm01_00131099 predicted 3946
8 SASI_Mm01_00131100 predicted 3740
9 SASI_Mm01_00131101 predicted 5172
10 SASI_Mm02_00321613 predicted 6614
11 SASI_Mm01_00131093 predicted 6281
12 SASI_Mm01_00131102 predicted 6553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011857
TENM3 MISSION shRNA Bacterial Glycerol Stock
teneurin transmembrane protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011857.2-774s1c1
Sequence:CCGGGCAGTAATGTACCACTGGAAACTCGAGTTTCCAGTGGTACATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011857.2-7196s1c1
Sequence:CCGGCCGGACATTGAAATCTGGAAACTCGAGTTTCCAGATTTCAATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011857.2-8531s1c1
Sequence:CCGGGCGTACAATGTTTCCAGATATCTCGAGATATCTGGAAACATTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011857.2-6545s1c1
Sequence:CCGGCGGTACAACTACGACCTAAATCTCGAGATTTAGGTCGTAGTTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011857.2-6544s1c1
Sequence:CCGGGCGGTACAACTACGACCTAAACTCGAGTTTAGGTCGTAGTTGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011857
TENM3 MISSION shRNA shRNA Plasmid DNA
teneurin transmembrane protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011857.2-774s1c1
Sequence:CCGGGCAGTAATGTACCACTGGAAACTCGAGTTTCCAGTGGTACATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011857.2-7196s1c1
Sequence:CCGGCCGGACATTGAAATCTGGAAACTCGAGTTTCCAGATTTCAATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011857.2-8531s1c1
Sequence:CCGGGCGTACAATGTTTCCAGATATCTCGAGATATCTGGAAACATTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011857.2-6545s1c1
Sequence:CCGGCGGTACAACTACGACCTAAATCTCGAGATTTAGGTCGTAGTTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011857.2-6544s1c1
Sequence:CCGGGCGGTACAACTACGACCTAAACTCGAGTTTAGGTCGTAGTTGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011857
TENM3 MISSION shRNA Lentiviral Transduction Particles
teneurin transmembrane protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011857.2-774s1c1
Sequence:CCGGGCAGTAATGTACCACTGGAAACTCGAGTTTCCAGTGGTACATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011857.2-7196s1c1
Sequence:CCGGCCGGACATTGAAATCTGGAAACTCGAGTTTCCAGATTTCAATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011857.2-8531s1c1
Sequence:CCGGGCGTACAATGTTTCCAGATATCTCGAGATATCTGGAAACATTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011857.2-6545s1c1
Sequence:CCGGCGGTACAACTACGACCTAAATCTCGAGATTTAGGTCGTAGTTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011857.2-6544s1c1
Sequence:CCGGGCGGTACAACTACGACCTAAACTCGAGTTTAGGTCGTAGTTGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080477
VALIDATED
TENM3 MISSION shRNA Bacterial Glycerol Stock
teneurin transmembrane protein 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080477.1-8313s21c1
Sequence:CCGGTGATCGGCTTTAACGAATATGCTCGAGCATATTCGTTAAAGCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080477.1-2058s21c1
Sequence:CCGGCAGACTGCTCAAACGAAATATCTCGAGATATTTCGTTTGAGCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080477.1-3098s21c1
Sequence:CCGGACCATGACCCAGTCTATTATTCTCGAGAATAATAGACTGGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080477.1-5401s21c1
Sequence:CCGGCTATGACGACCACCGTAAATTCTCGAGAATTTACGGTGGTCGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080477.1-6292s21c1
Sequence:CCGGCCGTATCAAGGAGATTCAATACTCGAGTATTGAATCTCCTTGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080477
VALIDATED
TENM3 MISSION shRNA shRNA Plasmid DNA
teneurin transmembrane protein 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080477.1-8313s21c1
Sequence:CCGGTGATCGGCTTTAACGAATATGCTCGAGCATATTCGTTAAAGCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080477.1-2058s21c1
Sequence:CCGGCAGACTGCTCAAACGAAATATCTCGAGATATTTCGTTTGAGCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080477.1-3098s21c1
Sequence:CCGGACCATGACCCAGTCTATTATTCTCGAGAATAATAGACTGGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080477.1-5401s21c1
Sequence:CCGGCTATGACGACCACCGTAAATTCTCGAGAATTTACGGTGGTCGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080477.1-6292s21c1
Sequence:CCGGCCGTATCAAGGAGATTCAATACTCGAGTATTGAATCTCCTTGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080477
VALIDATED
TENM3 MISSION shRNA Lentiviral Transduction Particles
teneurin transmembrane protein 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080477.1-8313s21c1
Sequence:CCGGTGATCGGCTTTAACGAATATGCTCGAGCATATTCGTTAAAGCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080477.1-2058s21c1
Sequence:CCGGCAGACTGCTCAAACGAAATATCTCGAGATATTTCGTTTGAGCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080477.1-3098s21c1
Sequence:CCGGACCATGACCCAGTCTATTATTCTCGAGAATAATAGACTGGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080477.1-5401s21c1
Sequence:CCGGCTATGACGACCACCGTAAATTCTCGAGAATTTACGGTGGTCGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080477.1-6292s21c1
Sequence:CCGGCCGTATCAAGGAGATTCAATACTCGAGTATTGAATCTCCTTGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks