EMAIL THIS PAGE TO A FRIEND

TENM4

teneurin transmembrane protein 4

Synonyms: Doc4 ODZ4 TNM4 Ten-M4
UniProtKB ID: Q6N022, A6ND26, Q7Z3C7, Q96MS6, Q9P2P4, Q9Y4S2
Gene ID:
Mouse(23966) teneurin transmembrane protein 4
Rat(308831) teneurin transmembrane protein 4
naked mole-rat(101722428) teneurin transmembrane protein 4
domestic guinea pig(100734624) teneurin transmembrane protein 4
sheep(101108614) teneurin transmembrane protein 4
domestic cat(101085744) teneurin transmembrane protein 4
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001098816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098816 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024511 MISSION® esiRNA esiRNA human ODZ4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098816 Rosetta Predictions human pricing
XM_166254 Rosetta Predictions human pricing
XM_001063599 Rosetta Predictions rat pricing
XM_218927 Rosetta Predictions rat pricing
NM_011858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320014 predicted 6026
2 SASI_Hs02_00320015 predicted 5134
3 SASI_Hs02_00320016 predicted 6768
4 SASI_Hs02_00320017 predicted 8422
5 SASI_Hs02_00320018 predicted 6374
6 SASI_Hs02_00320019 predicted 4515
7 SASI_Hs02_00320020 predicted 2823
8 SASI_Hs02_00320021 predicted 5202
9 SASI_Hs02_00320022 predicted 3723
10 SASI_Hs02_00320023 predicted 6099
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_166254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260199 predicted 5762
2 SASI_Hs01_00260200 predicted 4862
3 SASI_Hs01_00260201 predicted 6505
4 SASI_Hs01_00260202 predicted 7396
5 SASI_Hs01_00260203 predicted 8155
6 SASI_Hs01_00260204 predicted 6109
7 SASI_Hs01_00260205 predicted 4943
8 SASI_Hs01_00260206 predicted 2562
9 SASI_Hs01_00260207 predicted 4932
10 SASI_Hs01_00260208 predicted 3449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307757 predicted 4450
2 SASI_Rn02_00307758 predicted 5579
3 SASI_Rn02_00307759 predicted 4764
4 SASI_Rn02_00307760 predicted 2709
5 SASI_Rn02_00307761 predicted 3021
6 SASI_Rn02_00307762 predicted 6768
7 SASI_Rn02_00307763 predicted 4835
8 SASI_Rn02_00307764 predicted 572
9 SASI_Rn02_00307765 predicted 3516
10 SASI_Rn02_00307766 predicted 3249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378167 predicted 4444
2 SASI_Rn02_00378168 predicted 5583
3 SASI_Rn02_00378169 predicted 4771
4 SASI_Rn02_00378170 predicted 2709
5 SASI_Rn02_00378171 predicted 3020
6 SASI_Rn02_00378172 predicted 6770
7 SASI_Rn02_00378173 predicted 4837
8 SASI_Rn02_00378174 predicted 570
9 SASI_Rn02_00378175 predicted 3512
10 SASI_Rn02_00378176 predicted 3245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321614 predicted 5072
2 SASI_Mm01_00071931 predicted 5171
3 SASI_Mm02_00321615 predicted 7352
4 SASI_Mm01_00071932 predicted 7807
5 SASI_Mm01_00071933 predicted 5028
6 SASI_Mm02_00321616 predicted 2729
7 SASI_Mm01_00071934 predicted 6427
8 SASI_Mm02_00321617 predicted 4780
9 SASI_Mm01_00071938 predicted 5349
10 SASI_Mm01_00071939 predicted 6927
11 SASI_Mm01_00071935 predicted 7220
12 SASI_Mm01_00071936 predicted 5422
13 SASI_Mm01_00071937 predicted 3975
14 SASI_Mm01_00071940 predicted 811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011858
TENM4 MISSION shRNA Bacterial Glycerol Stock
teneurin transmembrane protein 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011858.3-5935s21c1
Sequence:CCGGTTCACCCTTCGGATCCTATATCTCGAGATATAGGATCCGAAGGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011858.3-2730s21c1
Sequence:CCGGCTATCTGGATAGGGTAGTTAACTCGAGTTAACTACCCTATCCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011858.1-4181s1c1
Sequence:CCGGCCGTGGGTTATGAGTATGAATCTCGAGATTCATACTCATAACCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011858.1-2472s1c1
Sequence:CCGGCGCCATTGAATCAGTGGATAACTCGAGTTATCCACTGATTCAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011858.1-6156s1c1
Sequence:CCGGGCCCATTGATAATGGCCTCAACTCGAGTTGAGGCCATTATCAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011858.1-9548s1c1
Sequence:CCGGGCTAACTTGTCTCGTGTGTAACTCGAGTTACACACGAGACAAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011858.1-6741s1c1
Sequence:CCGGCCTGTTACATACCTTCTACTTCTCGAGAAGTAGAAGGTATGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011858
TENM4 MISSION shRNA shRNA Plasmid DNA
teneurin transmembrane protein 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011858.3-5935s21c1
Sequence:CCGGTTCACCCTTCGGATCCTATATCTCGAGATATAGGATCCGAAGGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011858.3-2730s21c1
Sequence:CCGGCTATCTGGATAGGGTAGTTAACTCGAGTTAACTACCCTATCCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011858.1-4181s1c1
Sequence:CCGGCCGTGGGTTATGAGTATGAATCTCGAGATTCATACTCATAACCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011858.1-2472s1c1
Sequence:CCGGCGCCATTGAATCAGTGGATAACTCGAGTTATCCACTGATTCAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011858.1-6156s1c1
Sequence:CCGGGCCCATTGATAATGGCCTCAACTCGAGTTGAGGCCATTATCAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011858.1-9548s1c1
Sequence:CCGGGCTAACTTGTCTCGTGTGTAACTCGAGTTACACACGAGACAAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011858.1-6741s1c1
Sequence:CCGGCCTGTTACATACCTTCTACTTCTCGAGAAGTAGAAGGTATGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011858
TENM4 MISSION shRNA Lentiviral Transduction Particles
teneurin transmembrane protein 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011858.3-5935s21c1
Sequence:CCGGTTCACCCTTCGGATCCTATATCTCGAGATATAGGATCCGAAGGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011858.3-2730s21c1
Sequence:CCGGCTATCTGGATAGGGTAGTTAACTCGAGTTAACTACCCTATCCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011858.1-4181s1c1
Sequence:CCGGCCGTGGGTTATGAGTATGAATCTCGAGATTCATACTCATAACCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011858.1-2472s1c1
Sequence:CCGGCGCCATTGAATCAGTGGATAACTCGAGTTATCCACTGATTCAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011858.1-6156s1c1
Sequence:CCGGGCCCATTGATAATGGCCTCAACTCGAGTTGAGGCCATTATCAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011858.1-9548s1c1
Sequence:CCGGGCTAACTTGTCTCGTGTGTAACTCGAGTTACACACGAGACAAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011858.1-6741s1c1
Sequence:CCGGCCTGTTACATACCTTCTACTTCTCGAGAAGTAGAAGGTATGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098816
TENM4 MISSION shRNA Bacterial Glycerol Stock
teneurin transmembrane protein 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098816.2-10389s21c1
Sequence:CCGGCCTGGTTCATCCGCCTAATTACTCGAGTAATTAGGCGGATGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098816.2-3889s21c1
Sequence:CCGGTGAATCCTGCCCAGATCTAATCTCGAGATTAGATCTGGGCAGGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098816.2-8414s21c1
Sequence:CCGGCAGATCAACACAGTACTTAATCTCGAGATTAAGTACTGTGTTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098816.2-6958s21c1
Sequence:CCGGGATGACCGTCCAGTATGATAACTCGAGTTATCATACTGGACGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098816.2-5955s21c1
Sequence:CCGGTGCGGGTTCACAACCGAAATCCTCGAGGATTTCGGTTGTGAACCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098816
TENM4 MISSION shRNA shRNA Plasmid DNA
teneurin transmembrane protein 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098816.2-10389s21c1
Sequence:CCGGCCTGGTTCATCCGCCTAATTACTCGAGTAATTAGGCGGATGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098816.2-3889s21c1
Sequence:CCGGTGAATCCTGCCCAGATCTAATCTCGAGATTAGATCTGGGCAGGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098816.2-8414s21c1
Sequence:CCGGCAGATCAACACAGTACTTAATCTCGAGATTAAGTACTGTGTTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098816.2-6958s21c1
Sequence:CCGGGATGACCGTCCAGTATGATAACTCGAGTTATCATACTGGACGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098816.2-5955s21c1
Sequence:CCGGTGCGGGTTCACAACCGAAATCCTCGAGGATTTCGGTTGTGAACCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098816
TENM4 MISSION shRNA Lentiviral Transduction Particles
teneurin transmembrane protein 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098816.2-10389s21c1
Sequence:CCGGCCTGGTTCATCCGCCTAATTACTCGAGTAATTAGGCGGATGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098816.2-3889s21c1
Sequence:CCGGTGAATCCTGCCCAGATCTAATCTCGAGATTAGATCTGGGCAGGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098816.2-8414s21c1
Sequence:CCGGCAGATCAACACAGTACTTAATCTCGAGATTAAGTACTGTGTTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098816.2-6958s21c1
Sequence:CCGGGATGACCGTCCAGTATGATAACTCGAGTTATCATACTGGACGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098816.2-5955s21c1
Sequence:CCGGTGCGGGTTCACAACCGAAATCCTCGAGGATTTCGGTTGTGAACCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks