EMAIL THIS PAGE TO A FRIEND

TEP1

telomerase-associated protein 1

Synonyms: TLP1 TP1 TROVE1 VAULT2 p240
UniProtKB ID: Q99973, A0AUV9
Gene ID:
Human(7011) Summary: This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. [provided by RefSeq, Jul 2008]
Mouse(21745) telomerase associated protein 1
Rat(64523) telomerase associated protein 1
fruit fly(34937) Thioester-containing protein 1
dog(482555) telomerase-associated protein 1
Zebrafish(561284) telomerase-associated protein 1
Horse(100072576) telomerase-associated protein 1
domestic cat(101091203) telomerase-associated protein 1
domestic guinea pig(100722557) telomerase-associated protein 1
naked mole-rat(101715194) telomerase-associated protein 1
cow(505802) telomerase-associated protein 1
sheep(101117767) telomerase-associated protein 1
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007110 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007110 Rosetta Predictions human pricing
NM_022591 Rosetta Predictions rat pricing
NM_009351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083762 predicted 5136
2 SASI_Hs01_00083763 predicted 7521
3 SASI_Hs02_00342961 predicted 5981
4 SASI_Hs02_00342962 predicted 3691
5 SASI_Hs01_00083764 predicted 2836
6 SASI_Hs02_00342963 predicted 796
7 SASI_Hs01_00083766 predicted 1905
8 SASI_Hs01_00083767 predicted 1815
9 SASI_Hs01_00083768 predicted 3115
10 SASI_Hs01_00083769 predicted 6459
11 SASI_Hs01_00083760 predicted 7425
12 SASI_Hs01_00083761 predicted 948
13 SASI_Hs01_00083765 predicted 3321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069417 predicted 1020
2 SASI_Rn02_00263334 predicted 1319
3 SASI_Rn01_00069418 predicted 4314
4 SASI_Rn01_00069419 predicted 1175
5 SASI_Rn01_00069420 predicted 4476
6 SASI_Rn01_00069421 predicted 4241
7 SASI_Rn02_00263335 predicted 5949
8 SASI_Rn02_00263336 predicted 7406
9 SASI_Rn01_00069424 predicted 6125
10 SASI_Rn01_00069425 predicted 1488
11 SASI_Rn01_00069422 predicted 7521
12 SASI_Rn01_00069423 predicted 7589
13 SASI_Rn01_00069426 predicted 5392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172760 predicted 7170
2 SASI_Mm01_00172761 predicted 4264
3 SASI_Mm01_00172763 predicted 4191
4 SASI_Mm01_00172765 predicted 4293
5 SASI_Mm01_00172766 predicted 4273
6 SASI_Mm01_00172767 predicted 6078
7 SASI_Mm01_00172768 predicted 2448
8 SASI_Mm02_00315935 predicted 3397
9 SASI_Mm02_00315936 predicted 3966
10 SASI_Mm02_00315937 predicted 5903
11 SASI_Mm01_00172759 predicted 2755
12 SASI_Mm01_00172762 predicted 4428
13 SASI_Mm01_00172764 predicted 1435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007110
VALIDATED
TEP1 MISSION shRNA Bacterial Glycerol Stock
telomerase-associated protein 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.3-8068s1c1
Sequence:CCGGGCCTGTGTTCTCATGTGGATTCTCGAGAATCCACATGAGAACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.3-1008s1c1
Sequence:CCGGCGACGATATTTCTGTGCCATTCTCGAGAATGGCACAGAAATATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.3-7203s1c1
Sequence:CCGGGCCAAAGCAGATTTGAAGTTACTCGAGTAACTTCAAATCTGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.3-3163s1c1
Sequence:CCGGCCTGGAAATCTGACTTTGTTTCTCGAGAAACAAAGTCAGATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007110.3-5224s1c1
Sequence:CCGGCCGATGATACACTCTTTCTTACTCGAGTAAGAAAGAGTGTATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.x-7637s1c1
Sequence:CCGGTAGTGATGCCAGCATGGATAGCTCGAGCTATCCATGCTGGCATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007110.x-8157s1c1
Sequence:CCGGTAATCCTTACTAGAACCACAACTCGAGTTGTGGTTCTAGTAAGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.x-166s1c1
Sequence:CCGGCAGATATCCTCTCCTTGAAGACTCGAGTCTTCAAGGAGAGGATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-1126s21c1
Sequence:CCGGGTACTGCCATGACGGACAAATCTCGAGATTTGTCCGTCATGGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-7927s21c1
Sequence:CCGGGATGTGCCACTCGGGAATAATCTCGAGATTATTCCCGAGTGGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-7417s21c1
Sequence:CCGGATCCTAGTAGGACCCTAATATCTCGAGATATTAGGGTCCTACTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-1794s21c1
Sequence:CCGGTTGCCCTTTCCTTCGAATATACTCGAGTATATTCGAAGGAAAGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-3701s21c1
Sequence:CCGGCTATCTGCGTGGCCAACTAAACTCGAGTTTAGTTGGCCACGCAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007110
VALIDATED
TEP1 MISSION shRNA shRNA Plasmid DNA
telomerase-associated protein 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.3-8068s1c1
Sequence:CCGGGCCTGTGTTCTCATGTGGATTCTCGAGAATCCACATGAGAACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.3-1008s1c1
Sequence:CCGGCGACGATATTTCTGTGCCATTCTCGAGAATGGCACAGAAATATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.3-7203s1c1
Sequence:CCGGGCCAAAGCAGATTTGAAGTTACTCGAGTAACTTCAAATCTGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.3-3163s1c1
Sequence:CCGGCCTGGAAATCTGACTTTGTTTCTCGAGAAACAAAGTCAGATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007110.3-5224s1c1
Sequence:CCGGCCGATGATACACTCTTTCTTACTCGAGTAAGAAAGAGTGTATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.x-7637s1c1
Sequence:CCGGTAGTGATGCCAGCATGGATAGCTCGAGCTATCCATGCTGGCATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007110.x-8157s1c1
Sequence:CCGGTAATCCTTACTAGAACCACAACTCGAGTTGTGGTTCTAGTAAGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.x-166s1c1
Sequence:CCGGCAGATATCCTCTCCTTGAAGACTCGAGTCTTCAAGGAGAGGATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-1126s21c1
Sequence:CCGGGTACTGCCATGACGGACAAATCTCGAGATTTGTCCGTCATGGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-7927s21c1
Sequence:CCGGGATGTGCCACTCGGGAATAATCTCGAGATTATTCCCGAGTGGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-7417s21c1
Sequence:CCGGATCCTAGTAGGACCCTAATATCTCGAGATATTAGGGTCCTACTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-1794s21c1
Sequence:CCGGTTGCCCTTTCCTTCGAATATACTCGAGTATATTCGAAGGAAAGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-3701s21c1
Sequence:CCGGCTATCTGCGTGGCCAACTAAACTCGAGTTTAGTTGGCCACGCAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007110
VALIDATED
TEP1 MISSION shRNA Lentiviral Transduction Particles
telomerase-associated protein 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.3-8068s1c1
Sequence:CCGGGCCTGTGTTCTCATGTGGATTCTCGAGAATCCACATGAGAACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.3-1008s1c1
Sequence:CCGGCGACGATATTTCTGTGCCATTCTCGAGAATGGCACAGAAATATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.3-7203s1c1
Sequence:CCGGGCCAAAGCAGATTTGAAGTTACTCGAGTAACTTCAAATCTGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.3-3163s1c1
Sequence:CCGGCCTGGAAATCTGACTTTGTTTCTCGAGAAACAAAGTCAGATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007110.3-5224s1c1
Sequence:CCGGCCGATGATACACTCTTTCTTACTCGAGTAAGAAAGAGTGTATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.x-7637s1c1
Sequence:CCGGTAGTGATGCCAGCATGGATAGCTCGAGCTATCCATGCTGGCATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007110.x-8157s1c1
Sequence:CCGGTAATCCTTACTAGAACCACAACTCGAGTTGTGGTTCTAGTAAGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007110.x-166s1c1
Sequence:CCGGCAGATATCCTCTCCTTGAAGACTCGAGTCTTCAAGGAGAGGATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-1126s21c1
Sequence:CCGGGTACTGCCATGACGGACAAATCTCGAGATTTGTCCGTCATGGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-7927s21c1
Sequence:CCGGGATGTGCCACTCGGGAATAATCTCGAGATTATTCCCGAGTGGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-7417s21c1
Sequence:CCGGATCCTAGTAGGACCCTAATATCTCGAGATATTAGGGTCCTACTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-1794s21c1
Sequence:CCGGTTGCCCTTTCCTTCGAATATACTCGAGTATATTCGAAGGAAAGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007110.3-3701s21c1
Sequence:CCGGCTATCTGCGTGGCCAACTAAACTCGAGTTTAGTTGGCCACGCAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009351
TEP1 MISSION shRNA Bacterial Glycerol Stock
telomerase-associated protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-2329s1c1
Sequence:CCGGCGAGCAAGTGACTGTTTGCTTCTCGAGAAGCAAACAGTCACTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-5897s1c1
Sequence:CCGGGCTCAGTTATGGTCAGGATTTCTCGAGAAATCCTGACCATAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-7525s1c1
Sequence:CCGGCCTGGACTTCAATCTGAACTTCTCGAGAAGTTCAGATTGAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-7395s1c1
Sequence:CCGGGCAGGAGGTATGGAGTACATTCTCGAGAATGTACTCCATACCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-1298s1c1
Sequence:CCGGGCTAAGTACAACCCACGGAAACTCGAGTTTCCGTGGGTTGTACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009351
TEP1 MISSION shRNA shRNA Plasmid DNA
telomerase-associated protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-2329s1c1
Sequence:CCGGCGAGCAAGTGACTGTTTGCTTCTCGAGAAGCAAACAGTCACTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-5897s1c1
Sequence:CCGGGCTCAGTTATGGTCAGGATTTCTCGAGAAATCCTGACCATAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-7525s1c1
Sequence:CCGGCCTGGACTTCAATCTGAACTTCTCGAGAAGTTCAGATTGAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-7395s1c1
Sequence:CCGGGCAGGAGGTATGGAGTACATTCTCGAGAATGTACTCCATACCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-1298s1c1
Sequence:CCGGGCTAAGTACAACCCACGGAAACTCGAGTTTCCGTGGGTTGTACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009351
TEP1 MISSION shRNA Lentiviral Transduction Particles
telomerase-associated protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-2329s1c1
Sequence:CCGGCGAGCAAGTGACTGTTTGCTTCTCGAGAAGCAAACAGTCACTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-5897s1c1
Sequence:CCGGGCTCAGTTATGGTCAGGATTTCTCGAGAAATCCTGACCATAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-7525s1c1
Sequence:CCGGCCTGGACTTCAATCTGAACTTCTCGAGAAGTTCAGATTGAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-7395s1c1
Sequence:CCGGGCAGGAGGTATGGAGTACATTCTCGAGAATGTACTCCATACCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009351.1-1298s1c1
Sequence:CCGGGCTAAGTACAACCCACGGAAACTCGAGTTTCCGTGGGTTGTACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks