EMAIL THIS PAGE TO A FRIEND

TEPP

testis, prostate and placenta expressed

UniProtKB ID: Q6URK8, Q6URK7
Gene ID:
Mouse(73407) testis, prostate and placenta expressed
Rat(291850) testis, prostate and placenta expressed
dog(100685911) testis, prostate and placenta expressed
domestic cat(101092813) testis, prostate and placenta expressed
cow(618782) testis, prostate and placenta expressed
sheep(101121702) testis, prostate and placenta expressed
naked mole-rat(101719687) testis, prostate and placenta expressed
domestic guinea pig(100322869) testis, prostate and placenta expressed
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199046 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_028532 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028532 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028532 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199046 Rosetta Predictions human pricing
NM_199456 Rosetta Predictions human pricing
NM_201655 Rosetta Predictions rat pricing
NM_028532 Rosetta Predictions mouse pricing
NM_199455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247484 predicted 399
2 SASI_Hs01_00247485 predicted 301
3 SASI_Hs02_00372533 predicted 1032
4 SASI_Hs02_00372534 predicted 1059
5 SASI_Hs02_00372535 predicted 1126
6 SASI_Hs02_00372536 predicted 1048
7 SASI_Hs02_00372537 predicted 1031
8 SASI_Hs02_00372538 predicted 1075
9 SASI_Hs01_00247490 predicted 420
10 SASI_Hs01_00247491 predicted 287
11 SASI_Hs01_00247486 predicted 421
12 SASI_Hs01_00247487 predicted 502
13 SASI_Hs01_00247488 predicted 344
14 SASI_Hs01_00247489 predicted 503
15 SASI_Hs01_00247492 predicted 364
16 SASI_Hs01_00247493 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157561 predicted 400
2 SASI_Hs01_00157562 predicted 300
3 SASI_Hs02_00372861 predicted 958
4 SASI_Hs02_00372862 predicted 980
5 SASI_Hs02_00372863 predicted 1042
6 SASI_Hs02_00372864 predicted 968
7 SASI_Hs02_00372865 predicted 946
8 SASI_Hs02_00372866 predicted 990
9 SASI_Hs01_00157567 predicted 421
10 SASI_Hs01_00157568 predicted 286
11 SASI_Hs01_00157563 predicted 422
12 SASI_Hs01_00157564 predicted 505
13 SASI_Hs01_00157565 predicted 344
14 SASI_Hs01_00157566 predicted 501
15 SASI_Hs01_00157569 predicted 365
16 SASI_Hs01_00157570 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056549 predicted 389
2 SASI_Rn01_00056550 predicted 568
3 SASI_Rn02_00270340 predicted 619
4 SASI_Rn01_00056551 predicted 700
5 SASI_Rn01_00056552 predicted 478
6 SASI_Rn01_00056553 predicted 648
7 SASI_Rn01_00056554 predicted 381
8 SASI_Rn01_00056555 predicted 748
9 SASI_Rn01_00056556 predicted 520
10 SASI_Rn01_00056557 predicted 477
11 SASI_Rn01_00056548 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070843 predicted 363
2 SASI_Mm01_00070844 predicted 397
3 SASI_Mm01_00070845 predicted 284
4 SASI_Mm01_00070846 predicted 417
5 SASI_Mm01_00070847 predicted 323
6 SASI_Mm01_00070848 predicted 396
7 SASI_Mm01_00070849 predicted 324
8 SASI_Mm01_00070850 predicted 288
9 SASI_Mm01_00070851 predicted 348
10 SASI_Mm01_00070852 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148695 predicted 689
2 SASI_Mm01_00148696 predicted 719
3 SASI_Mm01_00148697 predicted 611
4 SASI_Mm01_00148698 predicted 746
5 SASI_Mm01_00148699 predicted 642
6 SASI_Mm01_00148700 predicted 716
7 SASI_Mm01_00148701 predicted 648
8 SASI_Mm01_00148702 predicted 604
9 SASI_Mm01_00148703 predicted 670
10 SASI_Mm01_00148704 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199046
TEPP MISSION shRNA Bacterial Glycerol Stock
testis, prostate and placenta expressed
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199046.2-1035s21c1
Sequence:CCGGGTTCAGCCTAACTAGAAATAACTCGAGTTATTTCTAGTTAGGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199046.2-1361s21c1
Sequence:CCGGGAGAGGGCTAGAAAGCTATTTCTCGAGAAATAGCTTTCTAGCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199046.1-129s1c1
Sequence:CCGGGTCAAAGAACTGAAAGTCCTTCTCGAGAAGGACTTTCAGTTCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-425s1c1
Sequence:CCGGGATGAATTTGACAACGCCCATCTCGAGATGGGCGTTGTCAAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-119s1c1
Sequence:CCGGCCATTGAGCAGTCAAAGAACTCTCGAGAGTTCTTTGACTGCTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-176s1c1
Sequence:CCGGCCTACAGATAAGGTAGCTGCTCTCGAGAGCAGCTACCTTATCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199046.1-117s1c1
Sequence:CCGGGCCCATTGAGCAGTCAAAGAACTCGAGTTCTTTGACTGCTCAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-64s1c1
Sequence:CCGGCTTTATTCTGCTGCTGTCCATCTCGAGATGGACAGCAGCAGAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-177s1c1
Sequence:CCGGCTACAGATAAGGTAGCTGCTACTCGAGTAGCAGCTACCTTATCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199046
TEPP MISSION shRNA shRNA Plasmid DNA
testis, prostate and placenta expressed
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199046.2-1035s21c1
Sequence:CCGGGTTCAGCCTAACTAGAAATAACTCGAGTTATTTCTAGTTAGGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199046.2-1361s21c1
Sequence:CCGGGAGAGGGCTAGAAAGCTATTTCTCGAGAAATAGCTTTCTAGCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199046.1-129s1c1
Sequence:CCGGGTCAAAGAACTGAAAGTCCTTCTCGAGAAGGACTTTCAGTTCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-425s1c1
Sequence:CCGGGATGAATTTGACAACGCCCATCTCGAGATGGGCGTTGTCAAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-119s1c1
Sequence:CCGGCCATTGAGCAGTCAAAGAACTCTCGAGAGTTCTTTGACTGCTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-176s1c1
Sequence:CCGGCCTACAGATAAGGTAGCTGCTCTCGAGAGCAGCTACCTTATCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199046.1-117s1c1
Sequence:CCGGGCCCATTGAGCAGTCAAAGAACTCGAGTTCTTTGACTGCTCAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-64s1c1
Sequence:CCGGCTTTATTCTGCTGCTGTCCATCTCGAGATGGACAGCAGCAGAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-177s1c1
Sequence:CCGGCTACAGATAAGGTAGCTGCTACTCGAGTAGCAGCTACCTTATCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199046
TEPP MISSION shRNA Lentiviral Transduction Particles
testis, prostate and placenta expressed
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199046.2-1035s21c1
Sequence:CCGGGTTCAGCCTAACTAGAAATAACTCGAGTTATTTCTAGTTAGGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199046.2-1361s21c1
Sequence:CCGGGAGAGGGCTAGAAAGCTATTTCTCGAGAAATAGCTTTCTAGCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199046.1-129s1c1
Sequence:CCGGGTCAAAGAACTGAAAGTCCTTCTCGAGAAGGACTTTCAGTTCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-425s1c1
Sequence:CCGGGATGAATTTGACAACGCCCATCTCGAGATGGGCGTTGTCAAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-119s1c1
Sequence:CCGGCCATTGAGCAGTCAAAGAACTCTCGAGAGTTCTTTGACTGCTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-176s1c1
Sequence:CCGGCCTACAGATAAGGTAGCTGCTCTCGAGAGCAGCTACCTTATCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199046.1-117s1c1
Sequence:CCGGGCCCATTGAGCAGTCAAAGAACTCGAGTTCTTTGACTGCTCAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-64s1c1
Sequence:CCGGCTTTATTCTGCTGCTGTCCATCTCGAGATGGACAGCAGCAGAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199046.1-177s1c1
Sequence:CCGGCTACAGATAAGGTAGCTGCTACTCGAGTAGCAGCTACCTTATCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199455
TEPP MISSION shRNA Bacterial Glycerol Stock
testis, prostate and placenta expressed
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000182023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199455.1-482s1c1
Sequence:CCGGCAGAAGCTCTGTCACAAGTATCTCGAGATACTTGTGACAGAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199455.1-331s1c1
Sequence:CCGGCATGGATATGGACACTGTCAACTCGAGTTGACAGTGTCCATATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199455
TEPP MISSION shRNA shRNA Plasmid DNA
testis, prostate and placenta expressed
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000182023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199455.1-482s1c1
Sequence:CCGGCAGAAGCTCTGTCACAAGTATCTCGAGATACTTGTGACAGAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199455.1-331s1c1
Sequence:CCGGCATGGATATGGACACTGTCAACTCGAGTTGACAGTGTCCATATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199455
TEPP MISSION shRNA Lentiviral Transduction Particles
testis, prostate and placenta expressed
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000182023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199455.1-482s1c1
Sequence:CCGGCAGAAGCTCTGTCACAAGTATCTCGAGATACTTGTGACAGAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199455.1-331s1c1
Sequence:CCGGCATGGATATGGACACTGTCAACTCGAGTTGACAGTGTCCATATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028532
TEPP MISSION shRNA Bacterial Glycerol Stock
testis, prostate and placenta expressed
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000200221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028532.1-475s1c1
Sequence:CCGGCAGTCGCATCAACTATCTGACCTCGAGGTCAGATAGTTGATGCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028532.1-470s1c1
Sequence:CCGGCACTACAGTCGCATCAACTATCTCGAGATAGTTGATGCGACTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028532
TEPP MISSION shRNA shRNA Plasmid DNA
testis, prostate and placenta expressed
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000200221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028532.1-475s1c1
Sequence:CCGGCAGTCGCATCAACTATCTGACCTCGAGGTCAGATAGTTGATGCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028532.1-470s1c1
Sequence:CCGGCACTACAGTCGCATCAACTATCTCGAGATAGTTGATGCGACTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028532
TEPP MISSION shRNA Lentiviral Transduction Particles
testis, prostate and placenta expressed
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000200221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028532.1-475s1c1
Sequence:CCGGCAGTCGCATCAACTATCTGACCTCGAGGTCAGATAGTTGATGCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028532.1-470s1c1
Sequence:CCGGCACTACAGTCGCATCAACTATCTCGAGATAGTTGATGCGACTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks