EMAIL THIS PAGE TO A FRIEND

TERF1

telomeric repeat binding factor (NIMA-interacting) 1

Synonyms: PIN2 TRBF1 TRF TRF1 hTRF1-AS t-TRF1
UniProtKB ID: P54274, A7XP29, Q15553, Q8NHT6, Q93029
Gene ID:
Human(7013) Summary: This gene encodes a telomere specific protein which is a component of the telomere nucleoprotein complex. This protein is present at telomeres throughout the cell cycle and functions as an inhibitor of telomerase, acting in cis to limit the elongation of individual chromosome ends. The protein structure contains a C-terminal Myb motif, a dimerization domain near its N-terminus and an acidic N-terminus. Two transcripts of this gene are alternatively spliced products. [provided by RefSeq, Jul 2008]
Mouse(21749) telomeric repeat binding factor 1
Rat(297758) telomeric repeat binding factor (NIMA-interacting) 1
cow(519474) telomeric repeat binding factor (NIMA-interacting) 1
sheep(101115973) telomeric repeat binding factor (NIMA-interacting) 1
domestic guinea pig(100731905) telomeric repeat binding factor (NIMA-interacting) 1
naked mole-rat(101725870) telomeric repeat binding factor (NIMA-interacting) 1
Zebrafish(566954) telomeric repeat binding factor (NIMA-interacting) 1
Horse(100051302) telomeric repeat binding factor (NIMA-interacting) 1
domestic cat(101098684) telomeric repeat binding factor (NIMA-interacting) 1
dog(100684790) telomeric repeat binding factor (NIMA-interacting) 1
chicken(378896) telomeric repeat binding factor (NIMA-interacting) 1
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017489 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003218 Rosetta Predictions human pricing
NM_017489 Rosetta Predictions human pricing
NM_001012464 Rosetta Predictions rat pricing
NM_009352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061220 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051034 predicted 617
2 SASI_Hs01_00051035 predicted 919
3 SASI_Hs01_00051036 predicted 916
4 SASI_Hs01_00051037 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012464 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067801 predicted 812
2 SASI_Rn01_00067802 predicted 1026
3 SASI_Rn01_00067805 predicted 297
4 SASI_Rn02_00200565 predicted 367
5 SASI_Rn01_00067806 predicted 420
6 SASI_Rn01_00067807 predicted 726
7 SASI_Rn02_00200566 predicted 553
8 SASI_Rn02_00200567 predicted 1021
9 SASI_Rn01_00067808 predicted 318
10 SASI_Rn01_00067809 predicted 901
11 SASI_Rn01_00067803 predicted 701
12 SASI_Rn01_00067804 predicted 509
13 SASI_Rn01_00067810 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111944 predicted 627
2 SASI_Mm01_00111945 predicted 294
3 SASI_Mm01_00111946 predicted 542
4 SASI_Mm01_00111947 predicted 482
5 SASI_Mm01_00111948 predicted 469
6 SASI_Mm01_00111949 predicted 560
7 SASI_Mm01_00111950 predicted 264
8 SASI_Mm01_00111951 predicted 471
9 SASI_Mm01_00111952 predicted 1056
10 SASI_Mm01_00111953 predicted 897
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017489
VALIDATED
TERF1 MISSION shRNA Bacterial Glycerol Stock
telomeric repeat binding factor (NIMA-interacting) 1
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017489.1-1753s1c1
Sequence:CCGGGCGCAATTTCAGCTCACTGAACTCGAGTTCAGTGAGCTGAAATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017489.1-96s1c1
Sequence:CCGGGATGGCAGAAACAGAGAGAAACTCGAGTTTCTCTCTGTTTCTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_017489.1-1004s1c1
Sequence:CCGGCCCAGCAACAAGACCTTAATACTCGAGTATTAAGGTCTTGTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_017489.1-425s1c1
Sequence:CCGGCCCTTGATGCACAGTTTGAAACTCGAGTTTCAAACTGTGCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017489.1-938s1c1
Sequence:CCGGCAGAGGGTACAGTATCCTTATCTCGAGATAAGGATACTGTACCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017489.x-560s1c1
Sequence:CCGGACAGAAGCAGTGGTCGAATCCTCGAGGATTCGACCACTGCTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017489.x-1647s1c1
Sequence:CCGGCAGAATTCACAGGAGCATGGTCTCGAGACCATGCTCCTGTGAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017489.x-1432s1c1
Sequence:CCGGCAGATGAAGACAGTACAACCACTCGAGTGGTTGTACTGTCTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017489.2-1485s21c1
Sequence:CCGGGTTTGTGCTACCAGAGTTAAACTCGAGTTTAACTCTGGTAGCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-878s21c1
Sequence:CCGGATGGAAACTGAAGCTAATTTGCTCGAGCAAATTAGCTTCAGTTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-1199s21c1
Sequence:CCGGAGATCTGGCGTGAGGAAATATCTCGAGATATTTCCTCACGCCAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-848s21c1
Sequence:CCGGCAAGATAAACCTAGTGGTAATCTCGAGATTACCACTAGGTTTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-333s21c1
Sequence:CCGGACAGCGCAGAGGCTATTATTCCTCGAGGAATAATAGCCTCTGCGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017489.2-1683s21c1
Sequence:CCGGCCTGTAACGTAACCCATTAAACTCGAGTTTAATGGGTTACGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-659s21c1
Sequence:CCGGAGCAAATTGCTTATGATAATCCTCGAGGATTATCATAAGCAATTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-1334s21c1
Sequence:CCGGAGCGAAGACTGATTGTGTTTGCTCGAGCAAACACAATCAGTCTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-1099s21c1
Sequence:CCGGTGAAAGCAGAATACCTGTTTCCTCGAGGAAACAGGTATTCTGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-925s21c1
Sequence:CCGGACAGTCTGCGGTAACTGAATCCTCGAGGATTCAGTTACCGCAGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017489
VALIDATED
TERF1 MISSION shRNA shRNA Plasmid DNA
telomeric repeat binding factor (NIMA-interacting) 1
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017489.1-1753s1c1
Sequence:CCGGGCGCAATTTCAGCTCACTGAACTCGAGTTCAGTGAGCTGAAATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017489.1-96s1c1
Sequence:CCGGGATGGCAGAAACAGAGAGAAACTCGAGTTTCTCTCTGTTTCTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_017489.1-1004s1c1
Sequence:CCGGCCCAGCAACAAGACCTTAATACTCGAGTATTAAGGTCTTGTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_017489.1-425s1c1
Sequence:CCGGCCCTTGATGCACAGTTTGAAACTCGAGTTTCAAACTGTGCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017489.1-938s1c1
Sequence:CCGGCAGAGGGTACAGTATCCTTATCTCGAGATAAGGATACTGTACCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017489.x-560s1c1
Sequence:CCGGACAGAAGCAGTGGTCGAATCCTCGAGGATTCGACCACTGCTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017489.x-1647s1c1
Sequence:CCGGCAGAATTCACAGGAGCATGGTCTCGAGACCATGCTCCTGTGAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017489.x-1432s1c1
Sequence:CCGGCAGATGAAGACAGTACAACCACTCGAGTGGTTGTACTGTCTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017489.2-1485s21c1
Sequence:CCGGGTTTGTGCTACCAGAGTTAAACTCGAGTTTAACTCTGGTAGCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-878s21c1
Sequence:CCGGATGGAAACTGAAGCTAATTTGCTCGAGCAAATTAGCTTCAGTTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-1199s21c1
Sequence:CCGGAGATCTGGCGTGAGGAAATATCTCGAGATATTTCCTCACGCCAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-848s21c1
Sequence:CCGGCAAGATAAACCTAGTGGTAATCTCGAGATTACCACTAGGTTTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-333s21c1
Sequence:CCGGACAGCGCAGAGGCTATTATTCCTCGAGGAATAATAGCCTCTGCGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017489.2-1683s21c1
Sequence:CCGGCCTGTAACGTAACCCATTAAACTCGAGTTTAATGGGTTACGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-659s21c1
Sequence:CCGGAGCAAATTGCTTATGATAATCCTCGAGGATTATCATAAGCAATTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-1334s21c1
Sequence:CCGGAGCGAAGACTGATTGTGTTTGCTCGAGCAAACACAATCAGTCTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-1099s21c1
Sequence:CCGGTGAAAGCAGAATACCTGTTTCCTCGAGGAAACAGGTATTCTGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-925s21c1
Sequence:CCGGACAGTCTGCGGTAACTGAATCCTCGAGGATTCAGTTACCGCAGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017489
VALIDATED
TERF1 MISSION shRNA Lentiviral Transduction Particles
telomeric repeat binding factor (NIMA-interacting) 1
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017489.1-1753s1c1
Sequence:CCGGGCGCAATTTCAGCTCACTGAACTCGAGTTCAGTGAGCTGAAATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017489.1-96s1c1
Sequence:CCGGGATGGCAGAAACAGAGAGAAACTCGAGTTTCTCTCTGTTTCTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_017489.1-1004s1c1
Sequence:CCGGCCCAGCAACAAGACCTTAATACTCGAGTATTAAGGTCTTGTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_017489.1-425s1c1
Sequence:CCGGCCCTTGATGCACAGTTTGAAACTCGAGTTTCAAACTGTGCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017489.1-938s1c1
Sequence:CCGGCAGAGGGTACAGTATCCTTATCTCGAGATAAGGATACTGTACCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017489.x-560s1c1
Sequence:CCGGACAGAAGCAGTGGTCGAATCCTCGAGGATTCGACCACTGCTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017489.x-1647s1c1
Sequence:CCGGCAGAATTCACAGGAGCATGGTCTCGAGACCATGCTCCTGTGAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017489.x-1432s1c1
Sequence:CCGGCAGATGAAGACAGTACAACCACTCGAGTGGTTGTACTGTCTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017489.2-1485s21c1
Sequence:CCGGGTTTGTGCTACCAGAGTTAAACTCGAGTTTAACTCTGGTAGCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-878s21c1
Sequence:CCGGATGGAAACTGAAGCTAATTTGCTCGAGCAAATTAGCTTCAGTTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-1199s21c1
Sequence:CCGGAGATCTGGCGTGAGGAAATATCTCGAGATATTTCCTCACGCCAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-848s21c1
Sequence:CCGGCAAGATAAACCTAGTGGTAATCTCGAGATTACCACTAGGTTTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-333s21c1
Sequence:CCGGACAGCGCAGAGGCTATTATTCCTCGAGGAATAATAGCCTCTGCGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017489.2-1683s21c1
Sequence:CCGGCCTGTAACGTAACCCATTAAACTCGAGTTTAATGGGTTACGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-659s21c1
Sequence:CCGGAGCAAATTGCTTATGATAATCCTCGAGGATTATCATAAGCAATTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-1334s21c1
Sequence:CCGGAGCGAAGACTGATTGTGTTTGCTCGAGCAAACACAATCAGTCTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-1099s21c1
Sequence:CCGGTGAAAGCAGAATACCTGTTTCCTCGAGGAAACAGGTATTCTGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017489.2-925s21c1
Sequence:CCGGACAGTCTGCGGTAACTGAATCCTCGAGGATTCAGTTACCGCAGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009352
VALIDATED
TERF1 MISSION shRNA Bacterial Glycerol Stock
telomeric repeat binding factor (NIMA-interacting) 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009352.2-1223s1c1
Sequence:CCGGCCGAACAAGTGTCATGTTAAACTCGAGTTTAACATGACACTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009352.2-297s1c1
Sequence:CCGGGAGGCTATTATTCATGGACTACTCGAGTAGTCCATGAATAATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009352.2-938s1c1
Sequence:CCGGGAACGCCTTATCGCAGTTAAACTCGAGTTTAACTGCGATAAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009352.2-443s1c1
Sequence:CCGGCCTGATGATTTGGAACTCAATCTCGAGATTGAGTTCCAAATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009352.2-532s1c1
Sequence:CCGGGTATGGAAATTGGCAGCTTTACTCGAGTAAAGCTGCCAATTTCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009352
VALIDATED
TERF1 MISSION shRNA shRNA Plasmid DNA
telomeric repeat binding factor (NIMA-interacting) 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009352.2-1223s1c1
Sequence:CCGGCCGAACAAGTGTCATGTTAAACTCGAGTTTAACATGACACTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009352.2-297s1c1
Sequence:CCGGGAGGCTATTATTCATGGACTACTCGAGTAGTCCATGAATAATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009352.2-938s1c1
Sequence:CCGGGAACGCCTTATCGCAGTTAAACTCGAGTTTAACTGCGATAAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009352.2-443s1c1
Sequence:CCGGCCTGATGATTTGGAACTCAATCTCGAGATTGAGTTCCAAATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009352.2-532s1c1
Sequence:CCGGGTATGGAAATTGGCAGCTTTACTCGAGTAAAGCTGCCAATTTCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009352
VALIDATED
TERF1 MISSION shRNA Lentiviral Transduction Particles
telomeric repeat binding factor (NIMA-interacting) 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009352.2-1223s1c1
Sequence:CCGGCCGAACAAGTGTCATGTTAAACTCGAGTTTAACATGACACTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009352.2-297s1c1
Sequence:CCGGGAGGCTATTATTCATGGACTACTCGAGTAGTCCATGAATAATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009352.2-938s1c1
Sequence:CCGGGAACGCCTTATCGCAGTTAAACTCGAGTTTAACTGCGATAAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009352.2-443s1c1
Sequence:CCGGCCTGATGATTTGGAACTCAATCTCGAGATTGAGTTCCAAATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009352.2-532s1c1
Sequence:CCGGGTATGGAAATTGGCAGCTTTACTCGAGTAAAGCTGCCAATTTCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks