EMAIL THIS PAGE TO A FRIEND

TERF1P2

telomeric repeat binding factor (NIMA-interacting) 1 pseudogene 2

Species: Human TERF1P2(646359)
Gene ID:
4 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001715947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001715947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001715947 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715947 Rosetta Predictions human pricing
XM_929288 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00407148 predicted 195
2 SASI_Hs02_00407149 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264745 predicted 196
2 SASI_Hs01_00264746 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001715947
TERF1P2 MISSION shRNA Bacterial Glycerol Stock
telomeric repeat binding factor (NIMA-interacting) 1 pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715947.1-309s21c2
Sequence:CCGGTTACCAGTTGAGAACGATATACTCGAGTATATCGTTCTCAACTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001715947.1-1335s21c2
Sequence:CCGGTCTGTGACCATCAATTAATATCTCGAGATATTAATTGATGGTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715947.1-264s21c2
Sequence:CCGGCAACAGCGCAGAGGCTATTATCTCGAGATAATAGCCTCTGCGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715947.1-888s21c2
Sequence:GTACCGGCCAGCAACAAGACCTTAATAACTCGAGTTATTAAGGTCTTGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715947.1-1140s21c2
Sequence:CCGGCCGGACAAGTGTCACATTAAACTCGAGTTTAATGTGACACTTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001715947
TERF1P2 MISSION shRNA shRNA Plasmid DNA
telomeric repeat binding factor (NIMA-interacting) 1 pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715947.1-309s21c2
Sequence:CCGGTTACCAGTTGAGAACGATATACTCGAGTATATCGTTCTCAACTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001715947.1-1335s21c2
Sequence:CCGGTCTGTGACCATCAATTAATATCTCGAGATATTAATTGATGGTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715947.1-264s21c2
Sequence:CCGGCAACAGCGCAGAGGCTATTATCTCGAGATAATAGCCTCTGCGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715947.1-888s21c2
Sequence:GTACCGGCCAGCAACAAGACCTTAATAACTCGAGTTATTAAGGTCTTGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715947.1-1140s21c2
Sequence:CCGGCCGGACAAGTGTCACATTAAACTCGAGTTTAATGTGACACTTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001715947
TERF1P2 MISSION shRNA Lentiviral Transduction Particles
telomeric repeat binding factor (NIMA-interacting) 1 pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715947.1-309s21c2
Sequence:CCGGTTACCAGTTGAGAACGATATACTCGAGTATATCGTTCTCAACTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001715947.1-1335s21c2
Sequence:CCGGTCTGTGACCATCAATTAATATCTCGAGATATTAATTGATGGTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715947.1-264s21c2
Sequence:CCGGCAACAGCGCAGAGGCTATTATCTCGAGATAATAGCCTCTGCGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715947.1-888s21c2
Sequence:GTACCGGCCAGCAACAAGACCTTAATAACTCGAGTTATTAAGGTCTTGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715947.1-1140s21c2
Sequence:CCGGCCGGACAAGTGTCACATTAAACTCGAGTTTAATGTGACACTTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks