EMAIL THIS PAGE TO A FRIEND

TERF1P5

telomeric repeat binding factor (NIMA-interacting) 1 pseudogene 5

Species: Human TERF1P5(283523)
Gene ID:
5 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001714856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001714856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001714856 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714856 Rosetta Predictions human pricing
XM_001716913 Rosetta Predictions human pricing
XM_001732870 Rosetta Predictions human pricing
XM_208097 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00399813 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00413796 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001732870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478512 predicted 310
2 SASI_Hs02_00478513 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_208097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294159 predicted 324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001714856
TERF1P5 MISSION shRNA Bacterial Glycerol Stock
telomeric repeat binding factor (NIMA-interacting) 1 pseudogene 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714856.1-394s21c1
Sequence:CCGGTACCAGTTGAGAATGATATACCTCGAGGTATATCATTCTCAACTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714856.1-1224s21c1
Sequence:CCGGCCGGACAAGTGTCATGTTAAACTCGAGTTTAACATGACACTTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714856.1-970s21c1
Sequence:CCGGACCCAGCAACAAGACCTTAATCTCGAGATTAAGGTCTTGTTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001714856.1-1709s21c1
Sequence:CCGGTGGAATACAATGGCACTATTTCTCGAGAAATAGTGCCATTGTATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714856.1-350s21c1
Sequence:CCGGACAGCGCAGAGGCTACTATTCCTCGAGGAATAGTAGCCTCTGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001714856
TERF1P5 MISSION shRNA shRNA Plasmid DNA
telomeric repeat binding factor (NIMA-interacting) 1 pseudogene 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714856.1-394s21c1
Sequence:CCGGTACCAGTTGAGAATGATATACCTCGAGGTATATCATTCTCAACTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714856.1-1224s21c1
Sequence:CCGGCCGGACAAGTGTCATGTTAAACTCGAGTTTAACATGACACTTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714856.1-970s21c1
Sequence:CCGGACCCAGCAACAAGACCTTAATCTCGAGATTAAGGTCTTGTTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001714856.1-1709s21c1
Sequence:CCGGTGGAATACAATGGCACTATTTCTCGAGAAATAGTGCCATTGTATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714856.1-350s21c1
Sequence:CCGGACAGCGCAGAGGCTACTATTCCTCGAGGAATAGTAGCCTCTGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001714856
TERF1P5 MISSION shRNA Lentiviral Transduction Particles
telomeric repeat binding factor (NIMA-interacting) 1 pseudogene 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714856.1-394s21c1
Sequence:CCGGTACCAGTTGAGAATGATATACCTCGAGGTATATCATTCTCAACTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714856.1-1224s21c1
Sequence:CCGGCCGGACAAGTGTCATGTTAAACTCGAGTTTAACATGACACTTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714856.1-970s21c1
Sequence:CCGGACCCAGCAACAAGACCTTAATCTCGAGATTAAGGTCTTGTTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001714856.1-1709s21c1
Sequence:CCGGTGGAATACAATGGCACTATTTCTCGAGAAATAGTGCCATTGTATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714856.1-350s21c1
Sequence:CCGGACAGCGCAGAGGCTACTATTCCTCGAGGAATAGTAGCCTCTGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks