EMAIL THIS PAGE TO A FRIEND

TERF2

telomeric repeat binding factor 2

Synonyms: TRBF2 TRF2
UniProtKB ID: Q15554
Gene ID:
Human(7014) Summary: This gene encodes a telomere specific protein, TERF2, which is a component of the telomere nucleoprotein complex. This protein is present at telomeres in metaphase of the cell cycle, is a second negative regulator of telomere length and plays a key role in the protective activity of telomeres. While having similar telomere binding activity and domain organization, TERF2 differs from TERF1 in that its N terminus is basic rather than acidic. [provided by RefSeq, Jul 2008]
Mouse(21750) telomeric repeat binding factor 2
Rat(361403) telomeric repeat binding factor 2
chicken(395598) telomeric repeat binding factor 2
domestic cat(101083387) telomeric repeat binding factor 2
dog(489736) telomeric repeat binding factor 2
naked mole-rat(101713552) telomeric repeat binding factor 2
domestic guinea pig(100723550) telomeric repeat binding factor 2
cow(506501) telomeric repeat binding factor 2
sheep(101113432) telomeric repeat binding factor 2
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005652 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009353 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009353 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009353 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005652 Rosetta Predictions human pricing
NM_001108448 Rosetta Predictions rat pricing
NM_001083118 Rosetta Predictions mouse pricing
NM_009353 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188701 predicted 1326
2 SASI_Hs01_00188703 predicted 1267
3 SASI_Hs01_00188704 predicted 1007
4 SASI_Hs01_00188705 predicted 956
5 SASI_Hs01_00188706 predicted 1049
6 SASI_Hs01_00188708 predicted 1441
7 SASI_Hs01_00188709 predicted 1185
8 SASI_Hs01_00188710 predicted 988
9 SASI_Hs02_00340020 predicted 951
10 SASI_Hs02_00340021 predicted 1331
11 SASI_Hs01_00188702 predicted 1448
12 SASI_Hs01_00188707 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238739 predicted 428
2 SASI_Rn02_00238740 predicted 472
3 SASI_Rn02_00238741 predicted 388
4 SASI_Rn02_00238742 predicted 773
5 SASI_Rn02_00238743 predicted 1521
6 SASI_Rn02_00238744 predicted 1171
7 SASI_Rn02_00238745 predicted 479
8 SASI_Rn02_00238746 predicted 348
9 SASI_Rn02_00238747 predicted 882
10 SASI_Rn02_00238748 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299474 predicted 605
2 SASI_Mm02_00299475 predicted 740
3 SASI_Mm02_00299476 predicted 725
4 SASI_Mm02_00299477 predicted 606
5 SASI_Mm02_00299478 predicted 736
6 SASI_Mm02_00299479 predicted 539
7 SASI_Mm02_00299480 predicted 478
8 SASI_Mm02_00299481 predicted 409
9 SASI_Mm02_00299482 predicted 595
10 SASI_Mm02_00299483 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315938 predicted 605
2 SASI_Mm01_00108411 predicted 740
3 SASI_Mm01_00108412 predicted 725
4 SASI_Mm01_00108413 predicted 602
5 SASI_Mm02_00315939 predicted 733
6 SASI_Mm02_00315940 predicted 538
7 SASI_Mm02_00315941 predicted 475
8 SASI_Mm02_00315942 predicted 400
9 SASI_Mm02_00315943 predicted 595
10 SASI_Mm02_00315944 predicted 739
11 SASI_Mm01_00108410 predicted 670
12 SASI_Mm01_00108414 predicted 1211
13 SASI_Mm01_00108415 predicted 699
14 SASI_Mm01_00108416 predicted 813
15 SASI_Mm01_00108417 predicted 806
16 SASI_Mm01_00108418 predicted 983
17 SASI_Mm01_00108419 predicted 1255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005652
VALIDATED
TERF2 MISSION shRNA Bacterial Glycerol Stock
telomeric repeat binding factor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005652.2-971s21c1
Sequence:CCGGCATTGGAATGATGACTCTGAACTCGAGTTCAGAGTCATCATTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005652.2-1190s21c1
Sequence:CCGGGCGCATGACAATAAGCAGATTCTCGAGAATCTGCTTATTGTCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005652.2-1320s21c1
Sequence:CCGGCCTGGAGAGAAGAATCCCAAACTCGAGTTTGGGATTCTTCTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005652.2-2178s21c1
Sequence:CCGGGCCAGAATATCATTAGCGTTTCTCGAGAAACGCTAATGATATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005652.2-1190s1c1
Sequence:CCGGGCGCATGACAATAAGCAGATTCTCGAGAATCTGCTTATTGTCATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005652.2-2178s1c1
Sequence:CCGGGCCAGAATATCATTAGCGTTTCTCGAGAAACGCTAATGATATTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005652.2-740s1c1
Sequence:CCGGCCATCCTGTTATCCAGAACTTCTCGAGAAGTTCTGGATAACAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005652.2-1320s1c1
Sequence:CCGGCCTGGAGAGAAGAATCCCAAACTCGAGTTTGGGATTCTTCTCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005652.2-971s1c1
Sequence:CCGGCATTGGAATGATGACTCTGAACTCGAGTTCAGAGTCATCATTCCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005652
VALIDATED
TERF2 MISSION shRNA shRNA Plasmid DNA
telomeric repeat binding factor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005652.2-971s21c1
Sequence:CCGGCATTGGAATGATGACTCTGAACTCGAGTTCAGAGTCATCATTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005652.2-1190s21c1
Sequence:CCGGGCGCATGACAATAAGCAGATTCTCGAGAATCTGCTTATTGTCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005652.2-1320s21c1
Sequence:CCGGCCTGGAGAGAAGAATCCCAAACTCGAGTTTGGGATTCTTCTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005652.2-2178s21c1
Sequence:CCGGGCCAGAATATCATTAGCGTTTCTCGAGAAACGCTAATGATATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005652.2-1190s1c1
Sequence:CCGGGCGCATGACAATAAGCAGATTCTCGAGAATCTGCTTATTGTCATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005652.2-2178s1c1
Sequence:CCGGGCCAGAATATCATTAGCGTTTCTCGAGAAACGCTAATGATATTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005652.2-740s1c1
Sequence:CCGGCCATCCTGTTATCCAGAACTTCTCGAGAAGTTCTGGATAACAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005652.2-1320s1c1
Sequence:CCGGCCTGGAGAGAAGAATCCCAAACTCGAGTTTGGGATTCTTCTCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005652.2-971s1c1
Sequence:CCGGCATTGGAATGATGACTCTGAACTCGAGTTCAGAGTCATCATTCCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005652
VALIDATED
TERF2 MISSION shRNA Lentiviral Transduction Particles
telomeric repeat binding factor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005652.2-971s21c1
Sequence:CCGGCATTGGAATGATGACTCTGAACTCGAGTTCAGAGTCATCATTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005652.2-1190s21c1
Sequence:CCGGGCGCATGACAATAAGCAGATTCTCGAGAATCTGCTTATTGTCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005652.2-1320s21c1
Sequence:CCGGCCTGGAGAGAAGAATCCCAAACTCGAGTTTGGGATTCTTCTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005652.2-2178s21c1
Sequence:CCGGGCCAGAATATCATTAGCGTTTCTCGAGAAACGCTAATGATATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005652.2-1190s1c1
Sequence:CCGGGCGCATGACAATAAGCAGATTCTCGAGAATCTGCTTATTGTCATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005652.2-2178s1c1
Sequence:CCGGGCCAGAATATCATTAGCGTTTCTCGAGAAACGCTAATGATATTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005652.2-740s1c1
Sequence:CCGGCCATCCTGTTATCCAGAACTTCTCGAGAAGTTCTGGATAACAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005652.2-1320s1c1
Sequence:CCGGCCTGGAGAGAAGAATCCCAAACTCGAGTTTGGGATTCTTCTCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005652.2-971s1c1
Sequence:CCGGCATTGGAATGATGACTCTGAACTCGAGTTCAGAGTCATCATTCCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009353
VALIDATED
TERF2 MISSION shRNA Bacterial Glycerol Stock
telomeric repeat binding factor 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009353.2-554s21c1
Sequence:CCGGCCTTGGAATCAGCTATCAATGCTCGAGCATTGATAGCTGATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009353.2-642s21c1
Sequence:CCGGCAAGGAGGCTGCTGTCATTATCTCGAGATAATGACAGCAGCCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009353.2-1939s21c1
Sequence:CCGGGAATCCCTAGTATTCCGTAAACTCGAGTTTACGGAATACTAGGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009353.2-1598s21c1
Sequence:CCGGACCGAACAGCTGTGATGATTACTCGAGTAATCATCACAGCTGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009353.2-1529s21c1
Sequence:CCGGTGAAGGATGGAGTGCGCAAATCTCGAGATTTGCGCACTCCATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009353.1-1703s1c1
Sequence:CCGGGCTGGAGATCATGGAGCTAAACTCGAGTTTAGCTCCATGATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009353.1-680s1c1
Sequence:CCGGCCACCCTGTTATCCAGAACTTCTCGAGAAGTTCTGGATAACAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009353.1-447s1c1
Sequence:CCGGCCCTTGGAATCAGCTATCAATCTCGAGATTGATAGCTGATTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009353.1-1494s1c1
Sequence:CCGGCGAACAGCTGTGATGATTAAACTCGAGTTTAATCATCACAGCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009353.1-1123s1c1
Sequence:CCGGGTCCCATGACAATAAGCAGATCTCGAGATCTGCTTATTGTCATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009353
VALIDATED
TERF2 MISSION shRNA shRNA Plasmid DNA
telomeric repeat binding factor 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009353.2-554s21c1
Sequence:CCGGCCTTGGAATCAGCTATCAATGCTCGAGCATTGATAGCTGATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009353.2-642s21c1
Sequence:CCGGCAAGGAGGCTGCTGTCATTATCTCGAGATAATGACAGCAGCCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009353.2-1939s21c1
Sequence:CCGGGAATCCCTAGTATTCCGTAAACTCGAGTTTACGGAATACTAGGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009353.2-1598s21c1
Sequence:CCGGACCGAACAGCTGTGATGATTACTCGAGTAATCATCACAGCTGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009353.2-1529s21c1
Sequence:CCGGTGAAGGATGGAGTGCGCAAATCTCGAGATTTGCGCACTCCATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009353.1-1703s1c1
Sequence:CCGGGCTGGAGATCATGGAGCTAAACTCGAGTTTAGCTCCATGATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009353.1-680s1c1
Sequence:CCGGCCACCCTGTTATCCAGAACTTCTCGAGAAGTTCTGGATAACAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009353.1-447s1c1
Sequence:CCGGCCCTTGGAATCAGCTATCAATCTCGAGATTGATAGCTGATTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009353.1-1494s1c1
Sequence:CCGGCGAACAGCTGTGATGATTAAACTCGAGTTTAATCATCACAGCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009353.1-1123s1c1
Sequence:CCGGGTCCCATGACAATAAGCAGATCTCGAGATCTGCTTATTGTCATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009353
VALIDATED
TERF2 MISSION shRNA Lentiviral Transduction Particles
telomeric repeat binding factor 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009353.2-554s21c1
Sequence:CCGGCCTTGGAATCAGCTATCAATGCTCGAGCATTGATAGCTGATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009353.2-642s21c1
Sequence:CCGGCAAGGAGGCTGCTGTCATTATCTCGAGATAATGACAGCAGCCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009353.2-1939s21c1
Sequence:CCGGGAATCCCTAGTATTCCGTAAACTCGAGTTTACGGAATACTAGGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009353.2-1598s21c1
Sequence:CCGGACCGAACAGCTGTGATGATTACTCGAGTAATCATCACAGCTGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009353.2-1529s21c1
Sequence:CCGGTGAAGGATGGAGTGCGCAAATCTCGAGATTTGCGCACTCCATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009353.1-1703s1c1
Sequence:CCGGGCTGGAGATCATGGAGCTAAACTCGAGTTTAGCTCCATGATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009353.1-680s1c1
Sequence:CCGGCCACCCTGTTATCCAGAACTTCTCGAGAAGTTCTGGATAACAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009353.1-447s1c1
Sequence:CCGGCCCTTGGAATCAGCTATCAATCTCGAGATTGATAGCTGATTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009353.1-1494s1c1
Sequence:CCGGCGAACAGCTGTGATGATTAAACTCGAGTTTAATCATCACAGCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009353.1-1123s1c1
Sequence:CCGGGTCCCATGACAATAAGCAGATCTCGAGATCTGCTTATTGTCATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks